Mutagenetix > Incidental Mutation

Incidental Mutation 'R4854:Gphn'

373820

Institutional Source

Beutler Lab

Gene Symbol

Gphn

Ensembl Gene

ENSMUSG00000047454

Gene Name

gephyrin

Synonyms

5730552E08Rik, geph

MMRRC Submission

042465-MU

Accession Numbers

Genbank: NM_145965, NM_172952; MGI: 109602

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4854 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

78226379-78684772 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 78627210 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 526 (V526M)

Ref Sequence

ENSEMBL: ENSMUSP00000054064 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052472] [ENSMUST00000110388]

AlphaFold

Q8BUV3

Predicted Effect

probably damaging
Transcript: ENSMUST00000052472
AA Change: V526M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000054064
Gene: ENSMUSG00000047454
AA Change: V526M

Domain	Start	End	E-Value	Type
MoCF_biosynth	18	165	4.52e-27	SMART
low complexity region	186	201	N/A	INTRINSIC
Pfam:MoeA_N	356	522	5.6e-53	PFAM
MoCF_biosynth	535	678	8.1e-38	SMART
Pfam:MoeA_C	691	766	8.9e-26	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000110388
AA Change: V529M

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000106018
Gene: ENSMUSG00000047454
AA Change: V529M

Domain	Start	End	E-Value	Type
MoCF_biosynth	18	165	4.52e-27	SMART
low complexity region	186	201	N/A	INTRINSIC
Pfam:MoeA_N	360	525	2.1e-35	PFAM
MoCF_biosynth	538	681	8.1e-38	SMART
Pfam:MoeA_C	694	769	8.1e-26	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.2%

Validation Efficiency

98% (103/105)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a neuronal assembly protein that anchors inhibitory neurotransmitter receptors to the postsynaptic cytoskeleton via high affinity binding to a receptor subunit domain and tubulin dimers. In nonneuronal tissues, the encoded protein is also required for molybdenum cofactor biosynthesis. Mutations in this gene may be associated with the neurological condition hyperplexia and also lead to molybdenum cofactor deficiency. Numerous alternatively spliced transcript variants encoding different isoforms have been described; however, the full-length nature of all transcript variants is not currently known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruption of this gene die within one day of birth, apparently due to an inability to suckle. Apnea also develops within 12 hours of birth. [provided by MGI curators]

Allele List at MGI

All alleles(11) : Targeted, knock-out(1) Gene trapped(10)

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810064F22Rik	T	A	9: 22,208,037		noncoding transcript	Het
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
Abl1	T	C	2: 31,779,010	Y110H	probably damaging	Het
Ablim2	C	T	5: 35,802,422	R73C	possibly damaging	Het
Agbl3	G	A	6: 34,785,284	R73Q	probably damaging	Het
Agl	C	T	3: 116,778,618		probably null	Het
Amotl1	G	A	9: 14,593,451	Q191*	probably null	Het
Apbb1ip	A	G	2: 22,853,202	K349E	possibly damaging	Het
Arhgap10	G	A	8: 77,420,089	Q229*	probably null	Het
Aspm	C	T	1: 139,478,072	Q1566*	probably null	Het
B3gnt3	G	A	8: 71,692,873	R284C	probably damaging	Het
Brd4	A	G	17: 32,220,237	V423A	probably damaging	Het
Btbd9	A	T	17: 30,524,865	I221N	probably damaging	Het
Camp	A	G	9: 109,847,451	V168A	probably benign	Het
Cd1d2	T	A	3: 86,989,249		probably null	Het
Cdkn2d	A	T	9: 21,290,927	V8D	probably benign	Het
Clec4g	T	C	8: 3,716,534	N256D	probably damaging	Het
Clspn	A	G	4: 126,575,950	I771V	probably benign	Het
Cntn6	A	G	6: 104,859,475	E862G	possibly damaging	Het
Col6a5	T	C	9: 105,898,751	T1702A	probably benign	Het
Dnah7a	T	C	1: 53,706,729		probably benign	Het
Dubr	T	C	16: 50,732,523		noncoding transcript	Het
Dusp26	G	A	8: 31,094,137	V91M	probably damaging	Het
Edc4	A	T	8: 105,887,925		probably benign	Het
F5	C	T	1: 164,192,146	A730V	probably damaging	Het
Foxf1	A	G	8: 121,086,814	T358A	probably benign	Het
Frem1	A	T	4: 82,916,758	N1810K	possibly damaging	Het
Galc	A	T	12: 98,256,877	F87I	probably damaging	Het
Gars	A	G	6: 55,046,418	D66G	probably damaging	Het
Gbp11	G	A	5: 105,325,508	L460F	probably damaging	Het
Gdf7	T	C	12: 8,298,014	I436V	probably damaging	Het
Gigyf2	C	T	1: 87,354,413		probably benign	Het
Gm12239	T	C	11: 56,015,953		noncoding transcript	Het
Gm5592	A	C	7: 41,217,471		probably benign	Het
Gp2	A	T	7: 119,452,199	D264E	possibly damaging	Het
Grid1	A	G	14: 35,321,641	I318V	probably benign	Het
Grm2	C	A	9: 106,654,132	V53F	possibly damaging	Het
Gtpbp1	T	C	15: 79,719,205	S632P	probably benign	Het
H2-M1	A	G	17: 36,670,058	F329L	probably benign	Het
Hecw1	T	A	13: 14,316,892	D92V	probably benign	Het
Hgh1	T	C	15: 76,369,182	L76P	probably damaging	Het
Idi2	C	A	13: 8,957,843	N63K	probably benign	Het
Ift122	A	G	6: 115,862,746	T25A	possibly damaging	Het
Itgb2l	A	T	16: 96,426,117	C575*	probably null	Het
Jup	A	G	11: 100,383,041	S225P	possibly damaging	Het
Kcng3	A	T	17: 83,588,306	C244S	probably damaging	Het
Klhl2	T	A	8: 64,834,459	M46L	possibly damaging	Het
Ksr1	A	T	11: 79,027,702	I460N	probably damaging	Het
Lama3	T	A	18: 12,411,542	F314Y	probably benign	Het
Lbp	T	C	2: 158,327,518	V421A	possibly damaging	Het
Lcp1	G	A	14: 75,200,489	G113D	probably damaging	Het
Lrp1b	A	T	2: 41,111,077	L2045H	probably damaging	Het
Mbd2	G	T	18: 70,568,735	D107Y	unknown	Het
Ms4a14	C	T	19: 11,310,369	V96I	possibly damaging	Het
N4bp2l2	C	T	5: 150,662,051	E155K	probably benign	Het
Nbeal2	T	G	9: 110,631,396	H1790P	probably damaging	Het
Nsg2	G	A	11: 32,031,806	G84R	probably benign	Het
Odf3	A	G	7: 140,849,462	Y168C	probably damaging	Het
Olfr1145	A	G	2: 87,810,590	T257A	probably damaging	Het
Olfr286	A	C	15: 98,227,544	F34V	possibly damaging	Het
P2rx2	T	C	5: 110,340,927	N224D	probably damaging	Het
P2rx5	A	T	11: 73,171,779	E438V	probably benign	Het
Paip1	C	A	13: 119,449,889		probably benign	Het
Pik3c2g	T	A	6: 139,768,779	V219E	probably damaging	Het
Ppp1r12b	T	C	1: 134,873,951	E509G	probably damaging	Het
Ppp1r15a	T	C	7: 45,525,373	S4G	probably benign	Het
Ppp5c	T	C	7: 17,009,022	S224G	probably benign	Het
Prr30	T	G	14: 101,198,443	I228L	probably benign	Het
Purg	A	G	8: 33,387,314	I327V	possibly damaging	Het
Ralb	T	C	1: 119,475,915	T161A	probably benign	Het
Ripor3	T	C	2: 167,992,813	R253G	probably benign	Het
Scgb2b6	T	C	7: 31,617,832		noncoding transcript	Het
Setd5	G	T	6: 113,151,399	G1438W	probably damaging	Het
Sh3rf3	T	A	10: 58,813,723	L50Q	possibly damaging	Het
Sipa1l2	G	T	8: 125,473,601	T662K	probably damaging	Het
Skint5	A	G	4: 113,580,528	L1021S	unknown	Het
Slc22a23	T	C	13: 34,203,941	S391G	probably benign	Het
Slc4a5	G	A	6: 83,271,017	V402I	probably benign	Het
Slco4c1	G	A	1: 96,841,228	P303L	probably damaging	Het
Spink5	A	T	18: 44,020,841	*1018C	probably null	Het
Stag3	T	A	5: 138,296,694		probably null	Het
Tmem117	T	C	15: 95,094,688	F410L	probably damaging	Het
Tmod1	A	G	4: 46,090,920	K158E	possibly damaging	Het
Tpsb2	GGCTGCTGCTGCTGCTG	GGCTGCTGCTGCTG	17: 25,366,562		probably benign	Het
Traf4	G	A	11: 78,161,520	Q100*	probably null	Het
Trpc4	A	G	3: 54,302,218	Y668C	probably damaging	Het
Ttn	T	A	2: 76,767,583	N11335I	possibly damaging	Het
Uhrf1bp1l	T	G	10: 89,794,484	V382G	probably damaging	Het
Usp39	A	T	6: 72,325,682	V463E	probably benign	Het
Vmn1r6	A	C	6: 57,002,698	Y115S	probably benign	Het
Vmn2r44	A	G	7: 8,380,301	I98T	possibly damaging	Het
Zfp462	A	G	4: 55,010,668	Y878C	probably damaging	Het
Zfp474	T	C	18: 52,638,431	I52T	possibly damaging	Het

Other mutations in Gphn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00338:Gphn	APN	12	78504632	missense	probably damaging	1.00
IGL00701:Gphn	APN	12	78626167	missense	possibly damaging	0.93
IGL00844:Gphn	APN	12	78664568	splice site	probably benign
IGL01517:Gphn	APN	12	78376374	missense	probably damaging	1.00
IGL02499:Gphn	APN	12	78492300	missense	probably benign	0.17
IGL02827:Gphn	APN	12	78609220	missense	probably damaging	1.00
IGL03136:Gphn	APN	12	78481333	missense	possibly damaging	0.69
IGL03348:Gphn	APN	12	78627119	missense	probably damaging	0.99
IGL03382:Gphn	APN	12	78481313	missense	probably damaging	1.00
grizzlies	UTSW	12	78654880	missense	probably benign	0.28
3-1:Gphn	UTSW	12	78613001	missense	probably benign	0.06
R0054:Gphn	UTSW	12	78637503	missense	probably damaging	1.00
R0054:Gphn	UTSW	12	78637503	missense	probably damaging	1.00
R0212:Gphn	UTSW	12	78637552	missense	probably damaging	0.99
R0389:Gphn	UTSW	12	78590659	missense	probably damaging	1.00
R0535:Gphn	UTSW	12	78492050	missense	possibly damaging	0.90
R1464:Gphn	UTSW	12	78612964	splice site	probably benign
R1503:Gphn	UTSW	12	78504629	missense	possibly damaging	0.94
R1606:Gphn	UTSW	12	78683883	missense	probably damaging	1.00
R1896:Gphn	UTSW	12	78412354	missense	possibly damaging	0.74
R2248:Gphn	UTSW	12	78454821	missense	probably damaging	1.00
R3708:Gphn	UTSW	12	78532693	missense	probably benign
R3907:Gphn	UTSW	12	78493942	splice site	probably benign
R4537:Gphn	UTSW	12	78494014	missense	probably benign	0.03
R4667:Gphn	UTSW	12	78454817	missense	probably damaging	1.00
R4808:Gphn	UTSW	12	78654880	missense	probably benign	0.28
R4840:Gphn	UTSW	12	78522955	critical splice donor site	probably null
R4852:Gphn	UTSW	12	78627210	missense	probably damaging	1.00
R4855:Gphn	UTSW	12	78627210	missense	probably damaging	1.00
R5083:Gphn	UTSW	12	78623289	splice site	probably null
R5224:Gphn	UTSW	12	78590587	missense	probably damaging	0.99
R5580:Gphn	UTSW	12	78492044	missense	probably damaging	1.00
R5626:Gphn	UTSW	12	78683897	missense	probably benign	0.11
R6270:Gphn	UTSW	12	78522950	missense	probably benign
R6563:Gphn	UTSW	12	78680396	critical splice donor site	probably null
R6943:Gphn	UTSW	12	78492181	missense	possibly damaging	0.88
R6958:Gphn	UTSW	12	78680299	missense	possibly damaging	0.86
R7170:Gphn	UTSW	12	78683889	missense	possibly damaging	0.67
R7295:Gphn	UTSW	12	78492102	missense	probably benign	0.02
R7514:Gphn	UTSW	12	78626165	missense	probably damaging	0.97
R7537:Gphn	UTSW	12	78504680	missense	possibly damaging	0.62
R7680:Gphn	UTSW	12	78412374	missense	probably benign	0.14
R8236:Gphn	UTSW	12	78664537	missense	probably damaging	1.00
R8377:Gphn	UTSW	12	78664506	missense	probably damaging	1.00
R8409:Gphn	UTSW	12	78613010	missense	probably damaging	1.00
R8468:Gphn	UTSW	12	78226827	missense	probably benign	0.22
R8742:Gphn	UTSW	12	78612992	missense	probably damaging	1.00
R8832:Gphn	UTSW	12	78412400	synonymous	silent
R8845:Gphn	UTSW	12	78492179	missense	probably benign	0.30
R8972:Gphn	UTSW	12	78609239	critical splice donor site	probably null
R9254:Gphn	UTSW	12	78627262	critical splice donor site	probably null
R9287:Gphn	UTSW	12	78562872	missense	possibly damaging	0.68
R9355:Gphn	UTSW	12	78492194	missense	probably damaging	0.97
R9536:Gphn	UTSW	12	78562862	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- GGCTCCTGACTCATTTCTGAAC -3'
(R):5'- ATGTGGTCCCATTGTTAAGAACC -3'

Sequencing Primer
(F):5'- TCCTCTCTAATACTAAAGTTTCCCTC -3'
(R):5'- GGTCCCATTGTTAAGAACCATAATC -3'

Posted On

2016-03-01