Mutagenetix > Incidental Mutations

Incidental Mutation 'R4854:Galc'

373821

Institutional Source

Beutler Lab

Gene Symbol

Galc

Ensembl Gene

ENSMUSG00000021003

Gene Name

galactosylceramidase

Synonyms

Gacy, A930008M05Rik, 2310068B06Rik, galactocerebrosidase

MMRRC Submission

042465-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4854 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

98202294-98259459 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 98256877 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 87 (F87I)

Ref Sequence

ENSEMBL: ENSMUSP00000021390 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021390]

AlphaFold

P54818

PDB Structure

STRUCTURE OF GALACTOCEREBROSIDASE FROM MOUSE [X-RAY DIFFRACTION]
STRUCTURE OF GALACTOCEREBROSIDASE FROM MOUSE IN COMPLEX WITH GALACTOSE [X-RAY DIFFRACTION]
STRUCTURE OF MOUSE GALACTOCEREBROSIDASE WITH 4NBDG: ENZYME-SUBSTRATE COMPLEX [X-RAY DIFFRACTION]
STRUCTURE OF MOUSE GALACTOCEREBROSIDASE WITH D-GALACTAL: ENZYME- INTERMEDIATE COMPLEX [X-RAY DIFFRACTION]
STRUCTURE OF MOUSE GALACTOCEREBROSIDASE WITH GALACTOSE: ENZYME- PRODUCT COMPLEX [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000021390
AA Change: F87I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000021390
Gene: ENSMUSG00000021003
AA Change: F87I

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_59	17	684	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218708

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220501

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221322

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222042

Meta Mutation Damage Score

0.9691

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.2%

Validation Efficiency

98% (103/105)

MGI Phenotype

FUNCTION: This gene encodes galactosylceramidase, the lysosomal hydryolase involved in the catabolism of galactosylceramide. Mutations in this gene result in slow growth, tremors and hind leg weakness, collectively termed as the 'twitcher' phenotype. In humans, deficiency of this gene product causes a lysosomal storage disorder known as Krabbe disease. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygotes for spontaneous and targeted mutations exhibit tremors, progressive weakness, wasting, both central and peripheral demyelination, massive accumulation of galactosylceramide, abnormal macrophages, and death by 4 months of age. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810064F22Rik	T	A	9: 22,208,037		noncoding transcript	Het
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
Abl1	T	C	2: 31,779,010	Y110H	probably damaging	Het
Ablim2	C	T	5: 35,802,422	R73C	possibly damaging	Het
Agbl3	G	A	6: 34,785,284	R73Q	probably damaging	Het
Agl	C	T	3: 116,778,618		probably null	Het
Amotl1	G	A	9: 14,593,451	Q191*	probably null	Het
Apbb1ip	A	G	2: 22,853,202	K349E	possibly damaging	Het
Arhgap10	G	A	8: 77,420,089	Q229*	probably null	Het
Aspm	C	T	1: 139,478,072	Q1566*	probably null	Het
B3gnt3	G	A	8: 71,692,873	R284C	probably damaging	Het
Brd4	A	G	17: 32,220,237	V423A	probably damaging	Het
Btbd9	A	T	17: 30,524,865	I221N	probably damaging	Het
Camp	A	G	9: 109,847,451	V168A	probably benign	Het
Cd1d2	T	A	3: 86,989,249		probably null	Het
Cdkn2d	A	T	9: 21,290,927	V8D	probably benign	Het
Clec4g	T	C	8: 3,716,534	N256D	probably damaging	Het
Clspn	A	G	4: 126,575,950	I771V	probably benign	Het
Cntn6	A	G	6: 104,859,475	E862G	possibly damaging	Het
Col6a5	T	C	9: 105,898,751	T1702A	probably benign	Het
Dnah7a	T	C	1: 53,706,729		probably benign	Het
Dubr	T	C	16: 50,732,523		noncoding transcript	Het
Dusp26	G	A	8: 31,094,137	V91M	probably damaging	Het
Edc4	A	T	8: 105,887,925		probably benign	Het
F5	C	T	1: 164,192,146	A730V	probably damaging	Het
Foxf1	A	G	8: 121,086,814	T358A	probably benign	Het
Frem1	A	T	4: 82,916,758	N1810K	possibly damaging	Het
Gars	A	G	6: 55,046,418	D66G	probably damaging	Het
Gbp11	G	A	5: 105,325,508	L460F	probably damaging	Het
Gdf7	T	C	12: 8,298,014	I436V	probably damaging	Het
Gigyf2	C	T	1: 87,354,413		probably benign	Het
Gm12239	T	C	11: 56,015,953		noncoding transcript	Het
Gm5592	A	C	7: 41,217,471		probably benign	Het
Gp2	A	T	7: 119,452,199	D264E	possibly damaging	Het
Gphn	G	A	12: 78,627,210	V526M	probably damaging	Het
Grid1	A	G	14: 35,321,641	I318V	probably benign	Het
Grm2	C	A	9: 106,654,132	V53F	possibly damaging	Het
Gtpbp1	T	C	15: 79,719,205	S632P	probably benign	Het
H2-M1	A	G	17: 36,670,058	F329L	probably benign	Het
Hecw1	T	A	13: 14,316,892	D92V	probably benign	Het
Hgh1	T	C	15: 76,369,182	L76P	probably damaging	Het
Idi2	C	A	13: 8,957,843	N63K	probably benign	Het
Ift122	A	G	6: 115,862,746	T25A	possibly damaging	Het
Itgb2l	A	T	16: 96,426,117	C575*	probably null	Het
Jup	A	G	11: 100,383,041	S225P	possibly damaging	Het
Kcng3	A	T	17: 83,588,306	C244S	probably damaging	Het
Klhl2	T	A	8: 64,834,459	M46L	possibly damaging	Het
Ksr1	A	T	11: 79,027,702	I460N	probably damaging	Het
Lama3	T	A	18: 12,411,542	F314Y	probably benign	Het
Lbp	T	C	2: 158,327,518	V421A	possibly damaging	Het
Lcp1	G	A	14: 75,200,489	G113D	probably damaging	Het
Lrp1b	A	T	2: 41,111,077	L2045H	probably damaging	Het
Mbd2	G	T	18: 70,568,735	D107Y	unknown	Het
Ms4a14	C	T	19: 11,310,369	V96I	possibly damaging	Het
N4bp2l2	C	T	5: 150,662,051	E155K	probably benign	Het
Nbeal2	T	G	9: 110,631,396	H1790P	probably damaging	Het
Nsg2	G	A	11: 32,031,806	G84R	probably benign	Het
Odf3	A	G	7: 140,849,462	Y168C	probably damaging	Het
Olfr1145	A	G	2: 87,810,590	T257A	probably damaging	Het
Olfr286	A	C	15: 98,227,544	F34V	possibly damaging	Het
P2rx2	T	C	5: 110,340,927	N224D	probably damaging	Het
P2rx5	A	T	11: 73,171,779	E438V	probably benign	Het
Paip1	C	A	13: 119,449,889		probably benign	Het
Pik3c2g	T	A	6: 139,768,779	V219E	probably damaging	Het
Ppp1r12b	T	C	1: 134,873,951	E509G	probably damaging	Het
Ppp1r15a	T	C	7: 45,525,373	S4G	probably benign	Het
Ppp5c	T	C	7: 17,009,022	S224G	probably benign	Het
Prr30	T	G	14: 101,198,443	I228L	probably benign	Het
Purg	A	G	8: 33,387,314	I327V	possibly damaging	Het
Ralb	T	C	1: 119,475,915	T161A	probably benign	Het
Ripor3	T	C	2: 167,992,813	R253G	probably benign	Het
Scgb2b6	T	C	7: 31,617,832		noncoding transcript	Het
Setd5	G	T	6: 113,151,399	G1438W	probably damaging	Het
Sh3rf3	T	A	10: 58,813,723	L50Q	possibly damaging	Het
Sipa1l2	G	T	8: 125,473,601	T662K	probably damaging	Het
Skint5	A	G	4: 113,580,528	L1021S	unknown	Het
Slc22a23	T	C	13: 34,203,941	S391G	probably benign	Het
Slc4a5	G	A	6: 83,271,017	V402I	probably benign	Het
Slco4c1	G	A	1: 96,841,228	P303L	probably damaging	Het
Spink5	A	T	18: 44,020,841	*1018C	probably null	Het
Stag3	T	A	5: 138,296,694		probably null	Het
Tmem117	T	C	15: 95,094,688	F410L	probably damaging	Het
Tmod1	A	G	4: 46,090,920	K158E	possibly damaging	Het
Tpsb2	GGCTGCTGCTGCTGCTG	GGCTGCTGCTGCTG	17: 25,366,562		probably benign	Het
Traf4	G	A	11: 78,161,520	Q100*	probably null	Het
Trpc4	A	G	3: 54,302,218	Y668C	probably damaging	Het
Ttn	T	A	2: 76,767,583	N11335I	possibly damaging	Het
Uhrf1bp1l	T	G	10: 89,794,484	V382G	probably damaging	Het
Usp39	A	T	6: 72,325,682	V463E	probably benign	Het
Vmn1r6	A	C	6: 57,002,698	Y115S	probably benign	Het
Vmn2r44	A	G	7: 8,380,301	I98T	possibly damaging	Het
Zfp462	A	G	4: 55,010,668	Y878C	probably damaging	Het
Zfp474	T	C	18: 52,638,431	I52T	possibly damaging	Het

Other mutations in Galc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01023:Galc	APN	12	98231422	missense	probably benign
IGL01287:Galc	APN	12	98246244	unclassified	probably benign
IGL01618:Galc	APN	12	98252081	missense	possibly damaging	0.92
IGL02125:Galc	APN	12	98231509	missense	probably damaging	1.00
IGL02274:Galc	APN	12	98254214	nonsense	probably null
IGL02392:Galc	APN	12	98207413	missense	probably damaging	0.99
IGL02478:Galc	APN	12	98213132	missense	possibly damaging	0.96
IGL02544:Galc	APN	12	98231442	missense	probably benign	0.27
IGL03268:Galc	APN	12	98222593	splice site	probably benign
IGL03327:Galc	APN	12	98207476	splice site	probably benign
Crabby2	UTSW	12	98234266	missense	probably damaging	1.00
Krabbe	UTSW	12	98222647	missense	probably damaging	1.00
lobster	UTSW	12	98246255	missense	probably null	0.84
quake	UTSW	12	98242714	missense	probably damaging	1.00
teeter	UTSW	12	98259162	missense	probably damaging	1.00
R0218:Galc	UTSW	12	98222647	missense	probably damaging	1.00
R0240:Galc	UTSW	12	98252034	missense	probably damaging	1.00
R0240:Galc	UTSW	12	98252034	missense	probably damaging	1.00
R0467:Galc	UTSW	12	98242645	missense	probably damaging	1.00
R1619:Galc	UTSW	12	98234304	missense	probably benign	0.00
R1763:Galc	UTSW	12	98234266	missense	probably damaging	1.00
R1832:Galc	UTSW	12	98234240	critical splice donor site	probably null
R1844:Galc	UTSW	12	98246297	splice site	probably null
R1996:Galc	UTSW	12	98252026	missense	probably damaging	1.00
R2010:Galc	UTSW	12	98254230	missense	possibly damaging	0.51
R2097:Galc	UTSW	12	98252032	missense	probably benign
R2496:Galc	UTSW	12	98227281	missense	probably damaging	1.00
R2881:Galc	UTSW	12	98213096	missense	probably benign
R3009:Galc	UTSW	12	98203969	missense	probably damaging	1.00
R4571:Galc	UTSW	12	98222617	missense	probably benign	0.00
R4764:Galc	UTSW	12	98242744	missense	possibly damaging	0.78
R4851:Galc	UTSW	12	98227274	missense	probably benign	0.00
R4900:Galc	UTSW	12	98231472	missense	probably damaging	1.00
R4983:Galc	UTSW	12	98242768	nonsense	probably null
R5220:Galc	UTSW	12	98231413	splice site	probably null
R5273:Galc	UTSW	12	98252071	missense	probably damaging	1.00
R5495:Galc	UTSW	12	98231414	critical splice donor site	probably null
R5689:Galc	UTSW	12	98212986	missense	possibly damaging	0.94
R5819:Galc	UTSW	12	98216261	missense	probably benign	0.06
R6191:Galc	UTSW	12	98252034	missense	probably damaging	1.00
R6196:Galc	UTSW	12	98259162	missense	probably damaging	1.00
R6305:Galc	UTSW	12	98259290	missense	possibly damaging	0.57
R6335:Galc	UTSW	12	98242714	missense	probably damaging	1.00
R7255:Galc	UTSW	12	98246255	missense	probably null	0.84
R7496:Galc	UTSW	12	98259238	nonsense	probably null
R7704:Galc	UTSW	12	98208843	missense	probably benign
R8871:Galc	UTSW	12	98246284	missense	probably damaging	1.00
R9124:Galc	UTSW	12	98254164	critical splice donor site	probably null
R9140:Galc	UTSW	12	98207414	missense	probably null	0.55
R9211:Galc	UTSW	12	98207440	missense	probably benign	0.00
R9220:Galc	UTSW	12	98254264	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCAAAGAGGCACCAAAGTTTG -3'
(R):5'- AGCATGGCAAATGACCCTC -3'

Sequencing Primer
(F):5'- TAAAACCTCGTAGAGGCC -3'
(R):5'- TGGCAAATGACCCTCCACAG -3'

Posted On

2016-03-01