Incidental Mutation 'R4854:Lcp1'
ID 373826
Institutional Source Beutler Lab
Gene Symbol Lcp1
Ensembl Gene ENSMUSG00000021998
Gene Name lymphocyte cytosolic protein 1
Synonyms L-fimbrin, L-plastin, D14Ertd310e, Pls2
MMRRC Submission 042465-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4854 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 75368545-75468282 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 75437929 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 113 (G113D)
Ref Sequence ENSEMBL: ENSMUSP00000121376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122840] [ENSMUST00000124499] [ENSMUST00000125833] [ENSMUST00000131802] [ENSMUST00000134114] [ENSMUST00000145303] [ENSMUST00000143539]
AlphaFold Q61233
Predicted Effect probably benign
Transcript: ENSMUST00000122840
SMART Domains Protein: ENSMUSP00000117984
Gene: ENSMUSG00000021998

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124499
AA Change: G113D

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000121201
Gene: ENSMUSG00000021998
AA Change: G113D

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
CH 122 234 1.15e-24 SMART
CH 266 373 1.51e-19 SMART
CH 396 501 1.87e-24 SMART
CH 517 622 8.55e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125833
SMART Domains Protein: ENSMUSP00000116033
Gene: ENSMUSG00000021998

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130510
Predicted Effect probably benign
Transcript: ENSMUST00000131802
AA Change: G113D

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000117137
Gene: ENSMUSG00000021998
AA Change: G113D

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
CH 122 234 1.15e-24 SMART
CH 266 373 1.51e-19 SMART
CH 396 501 1.87e-24 SMART
CH 517 622 8.55e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000134114
AA Change: G113D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121376
Gene: ENSMUSG00000021998
AA Change: G113D

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145303
AA Change: G113D

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000116271
Gene: ENSMUSG00000021998
AA Change: G113D

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
CH 122 234 1.15e-24 SMART
CH 266 373 1.51e-19 SMART
CH 396 501 1.87e-24 SMART
CH 517 622 8.55e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149883
Predicted Effect probably benign
Transcript: ENSMUST00000143539
SMART Domains Protein: ENSMUSP00000118721
Gene: ENSMUSG00000021998

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 76 4.45e1 SMART
Meta Mutation Damage Score 0.4778 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (103/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. Plastin 1 (otherwise known as Fimbrin) is a third distinct plastin isoform which is specifically expressed at high levels in the small intestine. The L isoform is expressed only in hemopoietic cell lineages, while the T isoform has been found in all other normal cells of solid tissues that have replicative potential (fibroblasts, endothelial cells, epithelial cells, melanocytes, etc.). However, L-plastin has been found in many types of malignant human cells of non-hemopoietic origin suggesting that its expression is induced accompanying tumorigenesis in solid tissues. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to S. aureus infection, defective neutrophil killing of S. aureus, and impaired adhesion-dependent respiratory bursts in neutrophils. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810064F22Rik T A 9: 22,119,333 (GRCm39) noncoding transcript Het
2700049A03Rik G T 12: 71,211,320 (GRCm39) E685* probably null Het
2700049A03Rik A T 12: 71,211,321 (GRCm39) E685V possibly damaging Het
Abl1 T C 2: 31,669,022 (GRCm39) Y110H probably damaging Het
Ablim2 C T 5: 35,959,766 (GRCm39) R73C possibly damaging Het
Agbl3 G A 6: 34,762,219 (GRCm39) R73Q probably damaging Het
Agl C T 3: 116,572,267 (GRCm39) probably null Het
Amotl1 G A 9: 14,504,747 (GRCm39) Q191* probably null Het
Apbb1ip A G 2: 22,743,214 (GRCm39) K349E possibly damaging Het
Arhgap10 G A 8: 78,146,718 (GRCm39) Q229* probably null Het
Aspm C T 1: 139,405,810 (GRCm39) Q1566* probably null Het
B3gnt3 G A 8: 72,145,517 (GRCm39) R284C probably damaging Het
Bltp3b T G 10: 89,630,346 (GRCm39) V382G probably damaging Het
Brd4 A G 17: 32,439,211 (GRCm39) V423A probably damaging Het
Btbd9 A T 17: 30,743,839 (GRCm39) I221N probably damaging Het
Camp A G 9: 109,676,519 (GRCm39) V168A probably benign Het
Cd1d2 T A 3: 86,896,556 (GRCm39) probably null Het
Cdkn2d A T 9: 21,202,223 (GRCm39) V8D probably benign Het
Cimap1a A G 7: 140,429,375 (GRCm39) Y168C probably damaging Het
Clec4g T C 8: 3,766,534 (GRCm39) N256D probably damaging Het
Clspn A G 4: 126,469,743 (GRCm39) I771V probably benign Het
Cntn6 A G 6: 104,836,436 (GRCm39) E862G possibly damaging Het
Col6a5 T C 9: 105,775,950 (GRCm39) T1702A probably benign Het
Dnah7a T C 1: 53,745,888 (GRCm39) probably benign Het
Dubr T C 16: 50,552,886 (GRCm39) noncoding transcript Het
Dusp26 G A 8: 31,584,165 (GRCm39) V91M probably damaging Het
Edc4 A T 8: 106,614,557 (GRCm39) probably benign Het
F5 C T 1: 164,019,715 (GRCm39) A730V probably damaging Het
Foxf1 A G 8: 121,813,553 (GRCm39) T358A probably benign Het
Frem1 A T 4: 82,834,995 (GRCm39) N1810K possibly damaging Het
Galc A T 12: 98,223,136 (GRCm39) F87I probably damaging Het
Gars1 A G 6: 55,023,403 (GRCm39) D66G probably damaging Het
Gbp11 G A 5: 105,473,374 (GRCm39) L460F probably damaging Het
Gdf7 T C 12: 8,348,014 (GRCm39) I436V probably damaging Het
Gigyf2 C T 1: 87,282,135 (GRCm39) probably benign Het
Gm12239 T C 11: 55,906,779 (GRCm39) noncoding transcript Het
Gm5592 A C 7: 40,866,895 (GRCm39) probably benign Het
Gp2 A T 7: 119,051,422 (GRCm39) D264E possibly damaging Het
Gphn G A 12: 78,673,984 (GRCm39) V526M probably damaging Het
Grid1 A G 14: 35,043,598 (GRCm39) I318V probably benign Het
Grm2 C A 9: 106,531,331 (GRCm39) V53F possibly damaging Het
Gtpbp1 T C 15: 79,603,406 (GRCm39) S632P probably benign Het
H2-M1 A G 17: 36,980,950 (GRCm39) F329L probably benign Het
Hecw1 T A 13: 14,491,477 (GRCm39) D92V probably benign Het
Hgh1 T C 15: 76,253,382 (GRCm39) L76P probably damaging Het
Idi2 C A 13: 9,007,879 (GRCm39) N63K probably benign Het
Ift122 A G 6: 115,839,707 (GRCm39) T25A possibly damaging Het
Itgb2l A T 16: 96,227,317 (GRCm39) C575* probably null Het
Jup A G 11: 100,273,867 (GRCm39) S225P possibly damaging Het
Kcng3 A T 17: 83,895,735 (GRCm39) C244S probably damaging Het
Klhl2 T A 8: 65,287,111 (GRCm39) M46L possibly damaging Het
Ksr1 A T 11: 78,918,528 (GRCm39) I460N probably damaging Het
Lama3 T A 18: 12,544,599 (GRCm39) F314Y probably benign Het
Lbp T C 2: 158,169,438 (GRCm39) V421A possibly damaging Het
Lrp1b A T 2: 41,001,089 (GRCm39) L2045H probably damaging Het
Mbd2 G T 18: 70,701,806 (GRCm39) D107Y unknown Het
Ms4a14 C T 19: 11,287,733 (GRCm39) V96I possibly damaging Het
N4bp2l2 C T 5: 150,585,516 (GRCm39) E155K probably benign Het
Nbeal2 T G 9: 110,460,464 (GRCm39) H1790P probably damaging Het
Nsg2 G A 11: 31,981,806 (GRCm39) G84R probably benign Het
Or10ad1b A C 15: 98,125,425 (GRCm39) F34V possibly damaging Het
Or12e10 A G 2: 87,640,934 (GRCm39) T257A probably damaging Het
P2rx2 T C 5: 110,488,793 (GRCm39) N224D probably damaging Het
P2rx5 A T 11: 73,062,605 (GRCm39) E438V probably benign Het
Paip1 C A 13: 119,586,425 (GRCm39) probably benign Het
Pik3c2g T A 6: 139,714,505 (GRCm39) V219E probably damaging Het
Ppp1r12b T C 1: 134,801,689 (GRCm39) E509G probably damaging Het
Ppp1r15a T C 7: 45,174,797 (GRCm39) S4G probably benign Het
Ppp5c T C 7: 16,742,947 (GRCm39) S224G probably benign Het
Prr30 T G 14: 101,435,879 (GRCm39) I228L probably benign Het
Purg A G 8: 33,877,342 (GRCm39) I327V possibly damaging Het
Ralb T C 1: 119,403,645 (GRCm39) T161A probably benign Het
Ripor3 T C 2: 167,834,733 (GRCm39) R253G probably benign Het
Scgb2b6 T C 7: 31,317,257 (GRCm39) noncoding transcript Het
Setd5 G T 6: 113,128,360 (GRCm39) G1438W probably damaging Het
Sh3rf3 T A 10: 58,649,545 (GRCm39) L50Q possibly damaging Het
Sipa1l2 G T 8: 126,200,340 (GRCm39) T662K probably damaging Het
Skint5 A G 4: 113,437,725 (GRCm39) L1021S unknown Het
Slc22a23 T C 13: 34,387,924 (GRCm39) S391G probably benign Het
Slc4a5 G A 6: 83,247,999 (GRCm39) V402I probably benign Het
Slco4c1 G A 1: 96,768,953 (GRCm39) P303L probably damaging Het
Spink5 A T 18: 44,153,908 (GRCm39) *1018C probably null Het
Stag3 T A 5: 138,294,956 (GRCm39) probably null Het
Tmem117 T C 15: 94,992,569 (GRCm39) F410L probably damaging Het
Tmod1 A G 4: 46,090,920 (GRCm39) K158E possibly damaging Het
Tpsb2 GGCTGCTGCTGCTGCTG GGCTGCTGCTGCTG 17: 25,585,536 (GRCm39) probably benign Het
Traf4 G A 11: 78,052,346 (GRCm39) Q100* probably null Het
Trpc4 A G 3: 54,209,639 (GRCm39) Y668C probably damaging Het
Ttn T A 2: 76,597,927 (GRCm39) N11335I possibly damaging Het
Usp39 A T 6: 72,302,665 (GRCm39) V463E probably benign Het
Vmn1r6 A C 6: 56,979,683 (GRCm39) Y115S probably benign Het
Vmn2r44 A G 7: 8,383,300 (GRCm39) I98T possibly damaging Het
Zfp462 A G 4: 55,010,668 (GRCm39) Y878C probably damaging Het
Zfp474 T C 18: 52,771,503 (GRCm39) I52T possibly damaging Het
Other mutations in Lcp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Lcp1 APN 14 75,464,533 (GRCm39) critical splice donor site probably null
IGL01768:Lcp1 APN 14 75,461,573 (GRCm39) missense probably benign 0.40
IGL01801:Lcp1 APN 14 75,436,815 (GRCm39) missense probably benign 0.10
IGL01940:Lcp1 APN 14 75,453,805 (GRCm39) missense probably benign 0.17
IGL02135:Lcp1 APN 14 75,437,926 (GRCm39) missense probably benign 0.00
IGL02185:Lcp1 APN 14 75,466,740 (GRCm39) missense possibly damaging 0.73
IGL02478:Lcp1 APN 14 75,461,536 (GRCm39) missense probably benign 0.04
IGL02604:Lcp1 APN 14 75,461,566 (GRCm39) missense probably benign 0.11
R0244:Lcp1 UTSW 14 75,464,441 (GRCm39) missense possibly damaging 0.92
R0295:Lcp1 UTSW 14 75,436,860 (GRCm39) missense probably null 0.59
R0313:Lcp1 UTSW 14 75,436,873 (GRCm39) missense probably damaging 1.00
R0415:Lcp1 UTSW 14 75,464,446 (GRCm39) missense possibly damaging 0.88
R0751:Lcp1 UTSW 14 75,436,827 (GRCm39) missense probably benign 0.00
R0811:Lcp1 UTSW 14 75,451,928 (GRCm39) missense probably benign 0.00
R0812:Lcp1 UTSW 14 75,451,928 (GRCm39) missense probably benign 0.00
R1200:Lcp1 UTSW 14 75,466,742 (GRCm39) missense possibly damaging 0.73
R1713:Lcp1 UTSW 14 75,436,884 (GRCm39) critical splice donor site probably null
R1915:Lcp1 UTSW 14 75,436,737 (GRCm39) missense possibly damaging 0.81
R1969:Lcp1 UTSW 14 75,437,946 (GRCm39) missense probably damaging 1.00
R1970:Lcp1 UTSW 14 75,437,946 (GRCm39) missense probably damaging 1.00
R1971:Lcp1 UTSW 14 75,437,946 (GRCm39) missense probably damaging 1.00
R2045:Lcp1 UTSW 14 75,437,841 (GRCm39) missense probably benign 0.01
R2064:Lcp1 UTSW 14 75,435,515 (GRCm39) critical splice acceptor site probably null
R3949:Lcp1 UTSW 14 75,443,569 (GRCm39) missense possibly damaging 0.68
R4062:Lcp1 UTSW 14 75,452,620 (GRCm39) missense probably damaging 1.00
R4521:Lcp1 UTSW 14 75,452,608 (GRCm39) missense possibly damaging 0.94
R4811:Lcp1 UTSW 14 75,437,848 (GRCm39) missense probably damaging 0.99
R4974:Lcp1 UTSW 14 75,445,911 (GRCm39) nonsense probably null
R5539:Lcp1 UTSW 14 75,466,738 (GRCm39) missense probably benign 0.08
R5561:Lcp1 UTSW 14 75,449,948 (GRCm39) missense probably benign 0.01
R5724:Lcp1 UTSW 14 75,464,422 (GRCm39) missense probably benign 0.18
R5989:Lcp1 UTSW 14 75,436,827 (GRCm39) missense probably benign 0.00
R6731:Lcp1 UTSW 14 75,443,629 (GRCm39) missense probably damaging 1.00
R7346:Lcp1 UTSW 14 75,447,946 (GRCm39) missense possibly damaging 0.49
R7670:Lcp1 UTSW 14 75,437,871 (GRCm39) missense probably benign 0.12
R7698:Lcp1 UTSW 14 75,443,651 (GRCm39) nonsense probably null
R9780:Lcp1 UTSW 14 75,440,178 (GRCm39) missense probably damaging 1.00
S24628:Lcp1 UTSW 14 75,464,446 (GRCm39) missense possibly damaging 0.88
X0027:Lcp1 UTSW 14 75,464,526 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAAGGCAAGAGGATTTGGGGT -3'
(R):5'- CATCCAGGTGGGTGTGCTT -3'

Sequencing Primer
(F):5'- CTGGAACTCACTTTGTAGACCAGG -3'
(R):5'- GTGCTTGCTTCTTTGCTTTTAGC -3'
Posted On 2016-03-01