Incidental Mutation 'R4854:Itgb2l'
ID373833
Institutional Source Beutler Lab
Gene Symbol Itgb2l
Ensembl Gene ENSMUSG00000000157
Gene Nameintegrin beta 2-like
Synonymspactolus, 5033406G21Rik
MMRRC Submission 042465-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R4854 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location96422288-96443619 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 96426117 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 575 (C575*)
Ref Sequence ENSEMBL: ENSMUSP00000109403 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000161] [ENSMUST00000113773] [ENSMUST00000113794] [ENSMUST00000113795] [ENSMUST00000131567] [ENSMUST00000136292]
Predicted Effect probably null
Transcript: ENSMUST00000000161
AA Change: C575*
SMART Domains Protein: ENSMUSP00000000161
Gene: ENSMUSG00000000157
AA Change: C575*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF_like 24 63 3.95e1 SMART
PSI 24 74 2.88e-4 SMART
INB 32 419 7.05e-119 SMART
VWA 126 329 1.16e0 SMART
EGF_like 553 585 4.64e1 SMART
Integrin_B_tail 594 669 1.22e-9 SMART
transmembrane domain 672 694 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113773
AA Change: C575*
SMART Domains Protein: ENSMUSP00000109403
Gene: ENSMUSG00000000157
AA Change: C575*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF_like 24 63 3.95e1 SMART
PSI 24 74 2.88e-4 SMART
INB 32 419 7.05e-119 SMART
VWA 126 329 1.16e0 SMART
EGF_like 553 585 4.64e1 SMART
Integrin_B_tail 594 669 1.22e-9 SMART
transmembrane domain 672 694 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113794
SMART Domains Protein: ENSMUSP00000109425
Gene: ENSMUSG00000000159

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 127 9.63e-6 SMART
IG 134 221 2.64e0 SMART
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113795
SMART Domains Protein: ENSMUSP00000109426
Gene: ENSMUSG00000000159

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 125 4.74e-5 SMART
transmembrane domain 139 161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131567
SMART Domains Protein: ENSMUSP00000114497
Gene: ENSMUSG00000000157

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PSI 24 74 2.88e-4 SMART
INB 32 419 7.05e-119 SMART
VWA 126 329 1.16e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131777
Predicted Effect probably benign
Transcript: ENSMUST00000136292
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (103/105)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display normal leukocyte development and normal neutrophil recruitment to inflamed tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810064F22Rik T A 9: 22,208,037 noncoding transcript Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abl1 T C 2: 31,779,010 Y110H probably damaging Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Agbl3 G A 6: 34,785,284 R73Q probably damaging Het
Agl C T 3: 116,778,618 probably null Het
Amotl1 G A 9: 14,593,451 Q191* probably null Het
Apbb1ip A G 2: 22,853,202 K349E possibly damaging Het
Arhgap10 G A 8: 77,420,089 Q229* probably null Het
Aspm C T 1: 139,478,072 Q1566* probably null Het
B3gnt3 G A 8: 71,692,873 R284C probably damaging Het
Brd4 A G 17: 32,220,237 V423A probably damaging Het
Btbd9 A T 17: 30,524,865 I221N probably damaging Het
Camp A G 9: 109,847,451 V168A probably benign Het
Cd1d2 T A 3: 86,989,249 probably null Het
Cdkn2d A T 9: 21,290,927 V8D probably benign Het
Clec4g T C 8: 3,716,534 N256D probably damaging Het
Clspn A G 4: 126,575,950 I771V probably benign Het
Cntn6 A G 6: 104,859,475 E862G possibly damaging Het
Col6a5 T C 9: 105,898,751 T1702A probably benign Het
Dnah7a T C 1: 53,706,729 probably benign Het
Dubr T C 16: 50,732,523 noncoding transcript Het
Dusp26 G A 8: 31,094,137 V91M probably damaging Het
Edc4 A T 8: 105,887,925 probably benign Het
F5 C T 1: 164,192,146 A730V probably damaging Het
Foxf1 A G 8: 121,086,814 T358A probably benign Het
Frem1 A T 4: 82,916,758 N1810K possibly damaging Het
Galc A T 12: 98,256,877 F87I probably damaging Het
Gars A G 6: 55,046,418 D66G probably damaging Het
Gbp11 G A 5: 105,325,508 L460F probably damaging Het
Gdf7 T C 12: 8,298,014 I436V probably damaging Het
Gigyf2 C T 1: 87,354,413 probably benign Het
Gm12239 T C 11: 56,015,953 noncoding transcript Het
Gm5592 A C 7: 41,217,471 probably benign Het
Gp2 A T 7: 119,452,199 D264E possibly damaging Het
Gphn G A 12: 78,627,210 V526M probably damaging Het
Grid1 A G 14: 35,321,641 I318V probably benign Het
Grm2 C A 9: 106,654,132 V53F possibly damaging Het
Gtpbp1 T C 15: 79,719,205 S632P probably benign Het
H2-M1 A G 17: 36,670,058 F329L probably benign Het
Hecw1 T A 13: 14,316,892 D92V probably benign Het
Hgh1 T C 15: 76,369,182 L76P probably damaging Het
Idi2 C A 13: 8,957,843 N63K probably benign Het
Ift122 A G 6: 115,862,746 T25A possibly damaging Het
Jup A G 11: 100,383,041 S225P possibly damaging Het
Kcng3 A T 17: 83,588,306 C244S probably damaging Het
Klhl2 T A 8: 64,834,459 M46L possibly damaging Het
Ksr1 A T 11: 79,027,702 I460N probably damaging Het
Lama3 T A 18: 12,411,542 F314Y probably benign Het
Lbp T C 2: 158,327,518 V421A possibly damaging Het
Lcp1 G A 14: 75,200,489 G113D probably damaging Het
Lrp1b A T 2: 41,111,077 L2045H probably damaging Het
Mbd2 G T 18: 70,568,735 D107Y unknown Het
Ms4a14 C T 19: 11,310,369 V96I possibly damaging Het
N4bp2l2 C T 5: 150,662,051 E155K probably benign Het
Nbeal2 T G 9: 110,631,396 H1790P probably damaging Het
Nsg2 G A 11: 32,031,806 G84R probably benign Het
Odf3 A G 7: 140,849,462 Y168C probably damaging Het
Olfr1145 A G 2: 87,810,590 T257A probably damaging Het
Olfr286 A C 15: 98,227,544 F34V possibly damaging Het
P2rx2 T C 5: 110,340,927 N224D probably damaging Het
P2rx5 A T 11: 73,171,779 E438V probably benign Het
Paip1 C A 13: 119,449,889 probably benign Het
Pik3c2g T A 6: 139,768,779 V219E probably damaging Het
Ppp1r12b T C 1: 134,873,951 E509G probably damaging Het
Ppp1r15a T C 7: 45,525,373 S4G probably benign Het
Ppp5c T C 7: 17,009,022 S224G probably benign Het
Prr30 T G 14: 101,198,443 I228L probably benign Het
Purg A G 8: 33,387,314 I327V possibly damaging Het
Ralb T C 1: 119,475,915 T161A probably benign Het
Ripor3 T C 2: 167,992,813 R253G probably benign Het
Scgb2b6 T C 7: 31,617,832 noncoding transcript Het
Setd5 G T 6: 113,151,399 G1438W probably damaging Het
Sh3rf3 T A 10: 58,813,723 L50Q possibly damaging Het
Sipa1l2 G T 8: 125,473,601 T662K probably damaging Het
Skint5 A G 4: 113,580,528 L1021S unknown Het
Slc22a23 T C 13: 34,203,941 S391G probably benign Het
Slc4a5 G A 6: 83,271,017 V402I probably benign Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Spink5 A T 18: 44,020,841 *1018C probably null Het
Stag3 T A 5: 138,296,694 probably null Het
Tmem117 T C 15: 95,094,688 F410L probably damaging Het
Tmod1 A G 4: 46,090,920 K158E possibly damaging Het
Tpsb2 GGCTGCTGCTGCTGCTG GGCTGCTGCTGCTG 17: 25,366,562 probably benign Het
Traf4 G A 11: 78,161,520 Q100* probably null Het
Trpc4 A G 3: 54,302,218 Y668C probably damaging Het
Ttn T A 2: 76,767,583 N11335I possibly damaging Het
Uhrf1bp1l T G 10: 89,794,484 V382G probably damaging Het
Usp39 A T 6: 72,325,682 V463E probably benign Het
Vmn1r6 A C 6: 57,002,698 Y115S probably benign Het
Vmn2r44 A G 7: 8,380,301 I98T possibly damaging Het
Zfp462 A G 4: 55,010,668 Y878C probably damaging Het
Zfp474 T C 18: 52,638,431 I52T possibly damaging Het
Other mutations in Itgb2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Itgb2l APN 16 96426750 missense probably damaging 0.98
IGL01482:Itgb2l APN 16 96438748 missense probably damaging 0.99
IGL01767:Itgb2l APN 16 96430575 missense probably benign 0.05
IGL02056:Itgb2l APN 16 96427689 missense probably damaging 0.97
IGL02072:Itgb2l APN 16 96430608 missense probably benign
IGL02858:Itgb2l APN 16 96422650 missense possibly damaging 0.96
R0011:Itgb2l UTSW 16 96427661 splice site probably benign
R0153:Itgb2l UTSW 16 96437369 missense possibly damaging 0.94
R0270:Itgb2l UTSW 16 96422930 unclassified probably benign
R0496:Itgb2l UTSW 16 96434701 missense possibly damaging 0.86
R0627:Itgb2l UTSW 16 96422911 unclassified probably benign
R1185:Itgb2l UTSW 16 96429040 missense possibly damaging 0.90
R1185:Itgb2l UTSW 16 96429040 missense possibly damaging 0.90
R1185:Itgb2l UTSW 16 96429040 missense possibly damaging 0.90
R1509:Itgb2l UTSW 16 96426849 missense probably benign 0.28
R1792:Itgb2l UTSW 16 96425082 missense probably damaging 1.00
R1912:Itgb2l UTSW 16 96426935 missense probably benign 0.17
R2210:Itgb2l UTSW 16 96426221 missense possibly damaging 0.82
R3160:Itgb2l UTSW 16 96437389 missense probably damaging 0.99
R3162:Itgb2l UTSW 16 96437389 missense probably damaging 0.99
R3836:Itgb2l UTSW 16 96426167 missense probably benign
R4131:Itgb2l UTSW 16 96437389 missense probably damaging 0.99
R4132:Itgb2l UTSW 16 96437389 missense probably damaging 0.99
R4254:Itgb2l UTSW 16 96430577 missense probably benign 0.00
R4893:Itgb2l UTSW 16 96427821 missense probably benign 0.12
R4931:Itgb2l UTSW 16 96437449 missense probably damaging 1.00
R5039:Itgb2l UTSW 16 96425005 missense possibly damaging 0.69
R5055:Itgb2l UTSW 16 96427803 missense probably damaging 1.00
R5960:Itgb2l UTSW 16 96426259 missense probably benign 0.00
R6412:Itgb2l UTSW 16 96427729 missense probably benign 0.04
R6966:Itgb2l UTSW 16 96430643 missense probably benign 0.02
R7149:Itgb2l UTSW 16 96433559 missense probably damaging 1.00
R7278:Itgb2l UTSW 16 96429043 missense probably damaging 1.00
R7293:Itgb2l UTSW 16 96426796 nonsense probably null
R7482:Itgb2l UTSW 16 96426833 missense probably benign 0.01
R7570:Itgb2l UTSW 16 96426239 missense probably benign 0.00
R7743:Itgb2l UTSW 16 96437408 missense probably damaging 1.00
R7771:Itgb2l UTSW 16 96426972 missense probably damaging 1.00
R8446:Itgb2l UTSW 16 96432657 missense probably damaging 1.00
X0018:Itgb2l UTSW 16 96435676 missense probably benign 0.01
Z1177:Itgb2l UTSW 16 96437356 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCAAGGGAAGTAAGACTC -3'
(R):5'- GGAAGATGAGTCCTGGCAAC -3'

Sequencing Primer
(F):5'- AATAAGGCCTCCCTGCTGAGTC -3'
(R):5'- AACCCCGGTTGTTTTCCAGAAAG -3'
Posted On2016-03-01