Incidental Mutation 'R4855:Met'
ID373884
Institutional Source Beutler Lab
Gene Symbol Met
Ensembl Gene ENSMUSG00000009376
Gene Namemet proto-oncogene
SynonymsPar4, HGF receptor, c-Met
MMRRC Submission 042466-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4855 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location17463800-17573980 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 17558797 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 1141 (L1141F)
Ref Sequence ENSEMBL: ENSMUSP00000111103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080469] [ENSMUST00000115442] [ENSMUST00000115443]
Predicted Effect probably damaging
Transcript: ENSMUST00000080469
AA Change: L1141F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079324
Gene: ENSMUSG00000009376
AA Change: L1141F

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 52 495 4.5e-134 SMART
PSI 518 561 1.18e-9 SMART
IPT 561 654 9.43e-15 SMART
IPT 655 738 4.16e-25 SMART
IPT 740 835 3.38e-16 SMART
IPT 837 933 4.08e-10 SMART
TyrKc 1076 1335 7.65e-134 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115442
AA Change: L1141F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111102
Gene: ENSMUSG00000009376
AA Change: L1141F

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 52 495 4.5e-134 SMART
PSI 518 561 1.18e-9 SMART
IPT 561 654 9.43e-15 SMART
IPT 655 738 4.16e-25 SMART
IPT 740 835 3.38e-16 SMART
IPT 837 933 4.08e-10 SMART
TyrKc 1076 1335 7.65e-134 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115443
AA Change: L1141F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111103
Gene: ENSMUSG00000009376
AA Change: L1141F

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 52 495 4.5e-134 SMART
PSI 518 561 1.18e-9 SMART
IPT 561 654 9.43e-15 SMART
IPT 655 738 4.16e-25 SMART
IPT 740 835 3.38e-16 SMART
IPT 837 933 4.08e-10 SMART
TyrKc 1076 1335 7.65e-134 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor tyrosine kinase family of proteins and the product of the proto-oncogene MET. The encoded preproprotein is proteolytically processed to generate alpha and beta subunits that are linked via disulfide bonds to form the mature receptor. Further processing of the beta subunit results in the formation of the M10 peptide, which has been shown to reduce lung fibrosis. Binding of its ligand, hepatocyte growth factor, induces dimerization and activation of the receptor, which plays a role in cellular survival, embryogenesis, and cellular migration and invasion. Mutations in this gene are associated with papillary renal cell carcinoma, hepatocellular carcinoma, and various head and neck cancers. Amplification and overexpression of this gene are also associated with multiple human cancers. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous null mutants exhibit impaired embryonic development resulting in death. Abnormalities observed in various mutant lines include muscle agenesis due to impaired migration of myogenic precursors, defects of motor axon migration, and placental andliver defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4921501E09Rik C T 17: 33,066,739 S363N probably benign Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Adad1 G T 3: 37,085,111 L443F probably damaging Het
Amph T A 13: 19,084,208 M70K probably damaging Het
Ankra2 T A 13: 98,273,411 L306H probably damaging Het
Arc A C 15: 74,671,743 D210E probably benign Het
Arhgap10 A G 8: 77,432,738 probably null Het
Atp8b5 T A 4: 43,344,449 N445K probably benign Het
C1qc G T 4: 136,890,435 Q117K probably benign Het
Cadps T A 14: 12,822,449 E97V unknown Het
Capn13 GCA G 17: 73,351,506 probably null Het
Cdk13 A T 13: 17,721,283 W1014R probably damaging Het
Cltb C T 13: 54,599,095 E23K probably damaging Het
Clvs2 A T 10: 33,622,646 I96N probably damaging Het
Cwf19l1 A G 19: 44,114,567 V403A probably damaging Het
Ddr2 A T 1: 169,988,497 L547Q possibly damaging Het
Ebf1 A T 11: 44,972,908 K354* probably null Het
Fam208b A T 13: 3,566,680 probably null Het
Fat4 A G 3: 38,888,317 Q453R probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gata6 A G 18: 11,054,497 E142G possibly damaging Het
Gm14221 T C 2: 160,574,680 noncoding transcript Het
Gm42791 C A 5: 148,959,437 probably benign Het
Gm6370 G T 5: 146,493,811 V269L probably benign Het
Gphn G A 12: 78,627,210 V526M probably damaging Het
Gpt A T 15: 76,699,285 E206V probably damaging Het
Grm3 G A 5: 9,570,047 A399V probably damaging Het
Helq A T 5: 100,783,159 V575E possibly damaging Het
Herc4 A G 10: 63,315,658 probably null Het
Ifi207 A T 1: 173,729,815 N452K probably damaging Het
Ikbke A G 1: 131,257,111 probably null Het
Kbtbd2 A G 6: 56,779,702 F350L probably benign Het
Kmt2c A G 5: 25,314,557 V2185A probably benign Het
Lgi2 T C 5: 52,538,507 Q362R probably damaging Het
Lrit1 G A 14: 37,061,816 G367E possibly damaging Het
Lrp1 G A 10: 127,610,442 H78Y probably benign Het
Matk A G 10: 81,262,886 probably benign Het
Med21 G A 6: 146,648,192 G24S probably damaging Het
Mroh3 A T 1: 136,200,939 probably null Het
Mrpl15 T C 1: 4,774,460 I203V probably benign Het
Naip1 T C 13: 100,423,220 probably null Het
Ndufa9 A C 6: 126,827,542 Y298* probably null Het
Neb T C 2: 52,298,894 E808G probably damaging Het
Nol4l C T 2: 153,411,806 G616S probably benign Het
Olfr1290 T G 2: 111,489,948 D70A probably damaging Het
Olfr1306 A G 2: 111,912,099 V277A probably benign Het
Olfr676 T A 7: 105,035,651 I151N probably damaging Het
Olfr700 T C 7: 106,806,256 M69V probably benign Het
Olfr988 T C 2: 85,353,449 N159S possibly damaging Het
Oprm1 T A 10: 6,838,468 C408S probably benign Het
Paqr3 A G 5: 97,108,194 I107T possibly damaging Het
Pex5l G A 3: 33,142,840 probably benign Het
Pik3ap1 T C 19: 41,327,845 D326G probably benign Het
Plaa G T 4: 94,586,408 D252E probably damaging Het
Plxna2 G A 1: 194,797,732 V1404I probably benign Het
Ppargc1a G A 5: 51,474,222 A355V possibly damaging Het
Primpol A G 8: 46,586,691 S350P probably benign Het
Prlr T C 15: 10,328,797 S453P probably benign Het
Psmd5 T C 2: 34,852,552 probably benign Het
Robo2 A T 16: 73,971,191 V571E probably damaging Het
Sbspon A T 1: 15,859,040 S176T possibly damaging Het
Scyl2 G A 10: 89,640,463 probably benign Het
Sema3e T A 5: 14,230,130 V341E probably damaging Het
Serpinb3b A T 1: 107,154,540 F331L possibly damaging Het
Setd2 A G 9: 110,571,954 H1736R probably benign Het
Sidt2 A T 9: 45,952,029 D180E probably benign Het
Skint9 A T 4: 112,391,011 Y179N probably benign Het
Slc27a5 T C 7: 12,988,633 N638S probably benign Het
Slc6a4 T A 11: 77,013,309 W197R probably damaging Het
Spag17 A T 3: 100,063,333 M1278L probably benign Het
Sptbn1 T A 11: 30,142,353 I471F probably damaging Het
Teddm1a A G 1: 153,892,636 Q282R probably benign Het
Tex35 A G 1: 157,099,725 L160P probably damaging Het
Tfap2c T C 2: 172,551,518 Y118H probably damaging Het
Tpp1 T C 7: 105,746,723 Q533R probably benign Het
Ttc13 C T 8: 124,674,435 D730N probably damaging Het
Ufc1 A G 1: 171,294,802 probably benign Het
Vcpip1 A G 1: 9,747,364 W265R probably damaging Het
Wdr11 C G 7: 129,600,434 probably null Het
Xirp2 A G 2: 67,511,064 I1216M possibly damaging Het
Zswim2 A G 2: 83,916,843 probably null Het
Other mutations in Met
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00533:Met APN 6 17534937 unclassified probably benign
IGL01066:Met APN 6 17535105 critical splice donor site probably null
IGL01344:Met APN 6 17547032 missense probably benign 0.44
IGL01413:Met APN 6 17558896 splice site probably benign
IGL01608:Met APN 6 17558730 missense probably damaging 1.00
IGL01613:Met APN 6 17540577 missense probably damaging 1.00
IGL01820:Met APN 6 17534231 missense possibly damaging 0.89
IGL01843:Met APN 6 17491701 missense probably damaging 1.00
IGL02014:Met APN 6 17527257 splice site probably benign
IGL02027:Met APN 6 17563727 splice site probably benign
IGL02243:Met APN 6 17549094 missense probably damaging 1.00
IGL02373:Met APN 6 17491529 missense probably damaging 1.00
IGL02616:Met APN 6 17553347 missense probably damaging 1.00
IGL02702:Met APN 6 17534143 missense possibly damaging 0.92
IGL02704:Met APN 6 17491257 missense possibly damaging 0.62
IGL02714:Met APN 6 17491852 nonsense probably null
IGL02936:Met APN 6 17553397 missense probably damaging 1.00
IGL02943:Met APN 6 17535929 missense possibly damaging 0.84
IGL03057:Met APN 6 17558766 missense probably damaging 1.00
IGL03124:Met APN 6 17492078 missense probably benign 0.27
IGL03171:Met APN 6 17562273 splice site probably benign
IGL03266:Met APN 6 17540538 missense possibly damaging 0.61
IGL03285:Met APN 6 17553337 missense probably damaging 0.98
R0453:Met UTSW 6 17534198 missense possibly damaging 0.88
R0543:Met UTSW 6 17491970 missense probably damaging 1.00
R0601:Met UTSW 6 17555632 splice site probably null
R0652:Met UTSW 6 17491710 missense probably benign 0.00
R0941:Met UTSW 6 17491394 missense probably damaging 1.00
R1142:Met UTSW 6 17527183 nonsense probably null
R1553:Met UTSW 6 17491461 missense probably benign 0.01
R1569:Met UTSW 6 17531504 nonsense probably null
R1744:Met UTSW 6 17540646 missense possibly damaging 0.47
R2224:Met UTSW 6 17563722 splice site probably null
R2308:Met UTSW 6 17491742 missense probably benign 0.00
R2369:Met UTSW 6 17531528 missense probably benign 0.04
R2393:Met UTSW 6 17534198 missense probably damaging 0.99
R2419:Met UTSW 6 17535830 splice site probably benign
R2483:Met UTSW 6 17549086 missense probably damaging 1.00
R2511:Met UTSW 6 17491967 missense probably damaging 1.00
R3622:Met UTSW 6 17549086 missense probably damaging 1.00
R3623:Met UTSW 6 17549086 missense probably damaging 1.00
R3624:Met UTSW 6 17549086 missense probably damaging 1.00
R4050:Met UTSW 6 17533984 missense probably benign
R4051:Met UTSW 6 17548729 missense possibly damaging 0.86
R4159:Met UTSW 6 17562272 splice site probably null
R4208:Met UTSW 6 17548729 missense possibly damaging 0.86
R4622:Met UTSW 6 17513384 missense probably benign 0.19
R4672:Met UTSW 6 17571804 missense probably benign 0.33
R4737:Met UTSW 6 17491541 missense probably damaging 1.00
R4738:Met UTSW 6 17491541 missense probably damaging 1.00
R4834:Met UTSW 6 17491413 missense probably damaging 0.97
R4846:Met UTSW 6 17491929 missense probably damaging 0.99
R4878:Met UTSW 6 17549059 missense probably damaging 1.00
R4902:Met UTSW 6 17546996 missense probably damaging 1.00
R5208:Met UTSW 6 17526423 nonsense probably null
R5355:Met UTSW 6 17491362 missense probably damaging 1.00
R5415:Met UTSW 6 17527085 missense probably benign 0.01
R5556:Met UTSW 6 17534176 missense probably benign 0.04
R5590:Met UTSW 6 17548782 missense probably benign 0.00
R5683:Met UTSW 6 17571744 missense probably damaging 1.00
R5872:Met UTSW 6 17562198 missense probably damaging 1.00
R5891:Met UTSW 6 17491539 missense probably benign 0.02
R5895:Met UTSW 6 17531582 missense probably benign 0.02
R6063:Met UTSW 6 17491968 missense probably damaging 1.00
R6262:Met UTSW 6 17553404 missense probably benign 0.00
R6362:Met UTSW 6 17558733 missense probably damaging 1.00
R6747:Met UTSW 6 17571467 missense probably damaging 1.00
R6966:Met UTSW 6 17531532 missense possibly damaging 0.65
R6989:Met UTSW 6 17535928 missense possibly damaging 0.67
R6989:Met UTSW 6 17535929 missense probably damaging 1.00
R7017:Met UTSW 6 17491287 nonsense probably null
R7037:Met UTSW 6 17547128 intron probably benign
R7141:Met UTSW 6 17527155 missense probably benign 0.01
R7242:Met UTSW 6 17491317 missense probably damaging 1.00
R7282:Met UTSW 6 17547012 nonsense probably null
R7624:Met UTSW 6 17558835 missense probably damaging 1.00
R7770:Met UTSW 6 17491407 missense possibly damaging 0.79
R7797:Met UTSW 6 17533953 missense probably damaging 1.00
R8082:Met UTSW 6 17492313 missense probably damaging 0.98
R8109:Met UTSW 6 17562237 missense probably damaging 1.00
R8162:Met UTSW 6 17547062 missense probably damaging 0.98
R8315:Met UTSW 6 17533957 missense probably damaging 0.99
R8325:Met UTSW 6 17571672 missense probably damaging 1.00
R8348:Met UTSW 6 17571800 missense probably benign 0.00
R8354:Met UTSW 6 17491769 missense probably damaging 1.00
R8448:Met UTSW 6 17571800 missense probably benign 0.00
R8454:Met UTSW 6 17491769 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCACCTGCTGGTTTTGGAC -3'
(R):5'- ACGTGCAGGCATCCCAATAC -3'

Sequencing Primer
(F):5'- TGTCCTCCAATGAGGCTA -3'
(R):5'- GCATTTGCTACTCTTGCAGAGGAC -3'
Posted On2016-03-01