Incidental Mutation 'R4855:Slc27a5'
ID373887
Institutional Source Beutler Lab
Gene Symbol Slc27a5
Ensembl Gene ENSMUSG00000030382
Gene Namesolute carrier family 27 (fatty acid transporter), member 5
SynonymsVLCSH2, FATP5, FACVL3, VLCS-H2
MMRRC Submission 042466-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R4855 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location12988346-12998192 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12988633 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 638 (N638S)
Ref Sequence ENSEMBL: ENSMUSP00000032539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032539] [ENSMUST00000045810] [ENSMUST00000108536] [ENSMUST00000120903]
Predicted Effect probably benign
Transcript: ENSMUST00000032539
AA Change: N638S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000032539
Gene: ENSMUSG00000030382
AA Change: N638S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 58 77 N/A INTRINSIC
Pfam:AMP-binding 119 557 1.3e-64 PFAM
Pfam:AMP-binding_C 565 641 1.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045810
SMART Domains Protein: ENSMUSP00000039073
Gene: ENSMUSG00000033961

DomainStartEndE-ValueType
low complexity region 67 79 N/A INTRINSIC
SCAN 122 234 1.29e-53 SMART
KRAB 299 360 3.96e-2 SMART
ZnF_C2H2 419 441 2.95e-3 SMART
ZnF_C2H2 468 490 8.47e-4 SMART
ZnF_C2H2 496 518 5.34e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108536
SMART Domains Protein: ENSMUSP00000104176
Gene: ENSMUSG00000033961

DomainStartEndE-ValueType
SCAN 22 134 1.29e-53 SMART
KRAB 199 260 3.96e-2 SMART
ZnF_C2H2 319 341 2.95e-3 SMART
ZnF_C2H2 368 390 8.47e-4 SMART
ZnF_C2H2 396 418 5.34e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120903
SMART Domains Protein: ENSMUSP00000112495
Gene: ENSMUSG00000030382

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 58 77 N/A INTRINSIC
Pfam:AMP-binding 119 414 2e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129268
AA Change: T86A
Predicted Effect probably benign
Transcript: ENSMUST00000133977
SMART Domains Protein: ENSMUSP00000117208
Gene: ENSMUSG00000030382

DomainStartEndE-ValueType
Pfam:AMP-binding 1 102 3.3e-8 PFAM
Pfam:AMP-binding 100 195 1.3e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155192
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an isozyme of very long-chain acyl-CoA synthetase (VLCS). It is capable of activating very long-chain fatty-acids containing 24- and 26-carbons. It is expressed in liver and associated with endoplasmic reticulum but not with peroxisomes. Its primary role is in fatty acid elongation or complex lipid synthesis rather than in degradation. This gene has a mouse ortholog. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit altered lipid homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4921501E09Rik C T 17: 33,066,739 S363N probably benign Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Adad1 G T 3: 37,085,111 L443F probably damaging Het
Amph T A 13: 19,084,208 M70K probably damaging Het
Ankra2 T A 13: 98,273,411 L306H probably damaging Het
Arc A C 15: 74,671,743 D210E probably benign Het
Arhgap10 A G 8: 77,432,738 probably null Het
Atp8b5 T A 4: 43,344,449 N445K probably benign Het
C1qc G T 4: 136,890,435 Q117K probably benign Het
Cadps T A 14: 12,822,449 E97V unknown Het
Capn13 GCA G 17: 73,351,506 probably null Het
Cdk13 A T 13: 17,721,283 W1014R probably damaging Het
Cltb C T 13: 54,599,095 E23K probably damaging Het
Clvs2 A T 10: 33,622,646 I96N probably damaging Het
Cwf19l1 A G 19: 44,114,567 V403A probably damaging Het
Ddr2 A T 1: 169,988,497 L547Q possibly damaging Het
Ebf1 A T 11: 44,972,908 K354* probably null Het
Fam208b A T 13: 3,566,680 probably null Het
Fat4 A G 3: 38,888,317 Q453R probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gata6 A G 18: 11,054,497 E142G possibly damaging Het
Gm14221 T C 2: 160,574,680 noncoding transcript Het
Gm42791 C A 5: 148,959,437 probably benign Het
Gm6370 G T 5: 146,493,811 V269L probably benign Het
Gphn G A 12: 78,627,210 V526M probably damaging Het
Gpt A T 15: 76,699,285 E206V probably damaging Het
Grm3 G A 5: 9,570,047 A399V probably damaging Het
Helq A T 5: 100,783,159 V575E possibly damaging Het
Herc4 A G 10: 63,315,658 probably null Het
Ifi207 A T 1: 173,729,815 N452K probably damaging Het
Ikbke A G 1: 131,257,111 probably null Het
Kbtbd2 A G 6: 56,779,702 F350L probably benign Het
Kmt2c A G 5: 25,314,557 V2185A probably benign Het
Lgi2 T C 5: 52,538,507 Q362R probably damaging Het
Lrit1 G A 14: 37,061,816 G367E possibly damaging Het
Lrp1 G A 10: 127,610,442 H78Y probably benign Het
Matk A G 10: 81,262,886 probably benign Het
Med21 G A 6: 146,648,192 G24S probably damaging Het
Met G T 6: 17,558,797 L1141F probably damaging Het
Mroh3 A T 1: 136,200,939 probably null Het
Mrpl15 T C 1: 4,774,460 I203V probably benign Het
Naip1 T C 13: 100,423,220 probably null Het
Ndufa9 A C 6: 126,827,542 Y298* probably null Het
Neb T C 2: 52,298,894 E808G probably damaging Het
Nol4l C T 2: 153,411,806 G616S probably benign Het
Olfr1290 T G 2: 111,489,948 D70A probably damaging Het
Olfr1306 A G 2: 111,912,099 V277A probably benign Het
Olfr676 T A 7: 105,035,651 I151N probably damaging Het
Olfr700 T C 7: 106,806,256 M69V probably benign Het
Olfr988 T C 2: 85,353,449 N159S possibly damaging Het
Oprm1 T A 10: 6,838,468 C408S probably benign Het
Paqr3 A G 5: 97,108,194 I107T possibly damaging Het
Pex5l G A 3: 33,142,840 probably benign Het
Pik3ap1 T C 19: 41,327,845 D326G probably benign Het
Plaa G T 4: 94,586,408 D252E probably damaging Het
Plxna2 G A 1: 194,797,732 V1404I probably benign Het
Ppargc1a G A 5: 51,474,222 A355V possibly damaging Het
Primpol A G 8: 46,586,691 S350P probably benign Het
Prlr T C 15: 10,328,797 S453P probably benign Het
Psmd5 T C 2: 34,852,552 probably benign Het
Robo2 A T 16: 73,971,191 V571E probably damaging Het
Sbspon A T 1: 15,859,040 S176T possibly damaging Het
Scyl2 G A 10: 89,640,463 probably benign Het
Sema3e T A 5: 14,230,130 V341E probably damaging Het
Serpinb3b A T 1: 107,154,540 F331L possibly damaging Het
Setd2 A G 9: 110,571,954 H1736R probably benign Het
Sidt2 A T 9: 45,952,029 D180E probably benign Het
Skint9 A T 4: 112,391,011 Y179N probably benign Het
Slc6a4 T A 11: 77,013,309 W197R probably damaging Het
Spag17 A T 3: 100,063,333 M1278L probably benign Het
Sptbn1 T A 11: 30,142,353 I471F probably damaging Het
Teddm1a A G 1: 153,892,636 Q282R probably benign Het
Tex35 A G 1: 157,099,725 L160P probably damaging Het
Tfap2c T C 2: 172,551,518 Y118H probably damaging Het
Tpp1 T C 7: 105,746,723 Q533R probably benign Het
Ttc13 C T 8: 124,674,435 D730N probably damaging Het
Ufc1 A G 1: 171,294,802 probably benign Het
Vcpip1 A G 1: 9,747,364 W265R probably damaging Het
Wdr11 C G 7: 129,600,434 probably null Het
Xirp2 A G 2: 67,511,064 I1216M possibly damaging Het
Zswim2 A G 2: 83,916,843 probably null Het
Other mutations in Slc27a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Slc27a5 APN 7 12988639 missense probably benign 0.08
IGL00906:Slc27a5 APN 7 12991057 missense probably benign 0.00
IGL01067:Slc27a5 APN 7 12989072 missense probably damaging 1.00
IGL02101:Slc27a5 APN 7 12993343 missense possibly damaging 0.95
IGL02148:Slc27a5 APN 7 12994951 missense probably damaging 0.97
IGL02165:Slc27a5 APN 7 12994948 missense probably damaging 0.99
IGL02324:Slc27a5 APN 7 12997560 missense probably benign 0.00
IGL02879:Slc27a5 APN 7 12995044 splice site probably benign
R1519:Slc27a5 UTSW 7 12988459 splice site probably null
R1662:Slc27a5 UTSW 7 12991246 missense probably damaging 1.00
R1774:Slc27a5 UTSW 7 12997607 nonsense probably null
R2012:Slc27a5 UTSW 7 12997707 missense probably damaging 0.98
R2020:Slc27a5 UTSW 7 12993412 missense probably damaging 1.00
R2886:Slc27a5 UTSW 7 12989560 unclassified probably benign
R4234:Slc27a5 UTSW 7 12988443 missense probably benign 0.01
R5126:Slc27a5 UTSW 7 12991320 missense probably damaging 1.00
R5450:Slc27a5 UTSW 7 12994942 missense probably benign 0.04
R5712:Slc27a5 UTSW 7 12998083 unclassified probably benign
R6302:Slc27a5 UTSW 7 12988552 missense probably damaging 1.00
R6346:Slc27a5 UTSW 7 12990972 missense possibly damaging 0.75
R6866:Slc27a5 UTSW 7 12997516 missense probably benign 0.00
R6921:Slc27a5 UTSW 7 12991208 missense probably damaging 1.00
R7329:Slc27a5 UTSW 7 12991162 missense possibly damaging 0.75
R8019:Slc27a5 UTSW 7 12989402 missense probably damaging 1.00
Z1177:Slc27a5 UTSW 7 12988855 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCGGACAACTTTGTGAAGC -3'
(R):5'- TTGATGGGCAGAAGCTATACCAG -3'

Sequencing Primer
(F):5'- CAACTTTGTGAAGCTGACTAGTGTC -3'
(R):5'- ATACCAGCATGTCCGCTCCTG -3'
Posted On2016-03-01