Incidental Mutation 'R4855:Prlr'
ID373914
Institutional Source Beutler Lab
Gene Symbol Prlr
Ensembl Gene ENSMUSG00000005268
Gene Nameprolactin receptor
SynonymsPrlr-rs1, Pr-1
MMRRC Submission 042466-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.535) question?
Stock #R4855 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location10177238-10349180 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10328797 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 453 (S453P)
Ref Sequence ENSEMBL: ENSMUSP00000122219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124470] [ENSMUST00000128450] [ENSMUST00000128921] [ENSMUST00000137867] [ENSMUST00000148257]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000005400
Predicted Effect probably benign
Transcript: ENSMUST00000124470
AA Change: S453P

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000122219
Gene: ENSMUSG00000005268
AA Change: S453P

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
transmembrane domain 231 253 N/A INTRINSIC
low complexity region 278 291 N/A INTRINSIC
low complexity region 342 356 N/A INTRINSIC
low complexity region 384 397 N/A INTRINSIC
low complexity region 454 467 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128450
SMART Domains Protein: ENSMUSP00000122209
Gene: ENSMUSG00000005268

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128921
SMART Domains Protein: ENSMUSP00000121280
Gene: ENSMUSG00000005268

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137867
SMART Domains Protein: ENSMUSP00000121935
Gene: ENSMUSG00000005268

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145428
Predicted Effect probably benign
Transcript: ENSMUST00000148257
SMART Domains Protein: ENSMUSP00000118355
Gene: ENSMUSG00000005268

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000157020
SMART Domains Protein: ENSMUSP00000120297
Gene: ENSMUSG00000094814

DomainStartEndE-ValueType
transmembrane domain 20 41 N/A INTRINSIC
Meta Mutation Damage Score 0.0874 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for the anterior pituitary hormone, prolactin, and belongs to the type I cytokine receptor family. Prolactin-dependent signaling occurs as the result of ligand-induced dimerization of the prolactin receptor. Several alternatively spliced transcript variants encoding different membrane-bound and soluble isoforms have been described for this gene, which may function to modulate the endocrine and autocrine effects of prolactin in normal tissue and cancer. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal growth, hormone and glucose homeostasis, hair cycling, female reproductive behavior, morphology, and function, and thyroid, prostate, Hardarian, and lacrimal gland morphologies. Heterozygous mice exhibit defective neuron proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4921501E09Rik C T 17: 33,066,739 S363N probably benign Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Adad1 G T 3: 37,085,111 L443F probably damaging Het
Amph T A 13: 19,084,208 M70K probably damaging Het
Ankra2 T A 13: 98,273,411 L306H probably damaging Het
Arc A C 15: 74,671,743 D210E probably benign Het
Arhgap10 A G 8: 77,432,738 probably null Het
Atp8b5 T A 4: 43,344,449 N445K probably benign Het
C1qc G T 4: 136,890,435 Q117K probably benign Het
Cadps T A 14: 12,822,449 E97V unknown Het
Capn13 GCA G 17: 73,351,506 probably null Het
Cdk13 A T 13: 17,721,283 W1014R probably damaging Het
Cltb C T 13: 54,599,095 E23K probably damaging Het
Clvs2 A T 10: 33,622,646 I96N probably damaging Het
Cwf19l1 A G 19: 44,114,567 V403A probably damaging Het
Ddr2 A T 1: 169,988,497 L547Q possibly damaging Het
Ebf1 A T 11: 44,972,908 K354* probably null Het
Fam208b A T 13: 3,566,680 probably null Het
Fat4 A G 3: 38,888,317 Q453R probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gata6 A G 18: 11,054,497 E142G possibly damaging Het
Gm14221 T C 2: 160,574,680 noncoding transcript Het
Gm42791 C A 5: 148,959,437 probably benign Het
Gm6370 G T 5: 146,493,811 V269L probably benign Het
Gphn G A 12: 78,627,210 V526M probably damaging Het
Gpt A T 15: 76,699,285 E206V probably damaging Het
Grm3 G A 5: 9,570,047 A399V probably damaging Het
Helq A T 5: 100,783,159 V575E possibly damaging Het
Herc4 A G 10: 63,315,658 probably null Het
Ifi207 A T 1: 173,729,815 N452K probably damaging Het
Ikbke A G 1: 131,257,111 probably null Het
Kbtbd2 A G 6: 56,779,702 F350L probably benign Het
Kmt2c A G 5: 25,314,557 V2185A probably benign Het
Lgi2 T C 5: 52,538,507 Q362R probably damaging Het
Lrit1 G A 14: 37,061,816 G367E possibly damaging Het
Lrp1 G A 10: 127,610,442 H78Y probably benign Het
Matk A G 10: 81,262,886 probably benign Het
Med21 G A 6: 146,648,192 G24S probably damaging Het
Met G T 6: 17,558,797 L1141F probably damaging Het
Mroh3 A T 1: 136,200,939 probably null Het
Mrpl15 T C 1: 4,774,460 I203V probably benign Het
Naip1 T C 13: 100,423,220 probably null Het
Ndufa9 A C 6: 126,827,542 Y298* probably null Het
Neb T C 2: 52,298,894 E808G probably damaging Het
Nol4l C T 2: 153,411,806 G616S probably benign Het
Olfr1290 T G 2: 111,489,948 D70A probably damaging Het
Olfr1306 A G 2: 111,912,099 V277A probably benign Het
Olfr676 T A 7: 105,035,651 I151N probably damaging Het
Olfr700 T C 7: 106,806,256 M69V probably benign Het
Olfr988 T C 2: 85,353,449 N159S possibly damaging Het
Oprm1 T A 10: 6,838,468 C408S probably benign Het
Paqr3 A G 5: 97,108,194 I107T possibly damaging Het
Pex5l G A 3: 33,142,840 probably benign Het
Pik3ap1 T C 19: 41,327,845 D326G probably benign Het
Plaa G T 4: 94,586,408 D252E probably damaging Het
Plxna2 G A 1: 194,797,732 V1404I probably benign Het
Ppargc1a G A 5: 51,474,222 A355V possibly damaging Het
Primpol A G 8: 46,586,691 S350P probably benign Het
Psmd5 T C 2: 34,852,552 probably benign Het
Robo2 A T 16: 73,971,191 V571E probably damaging Het
Sbspon A T 1: 15,859,040 S176T possibly damaging Het
Scyl2 G A 10: 89,640,463 probably benign Het
Sema3e T A 5: 14,230,130 V341E probably damaging Het
Serpinb3b A T 1: 107,154,540 F331L possibly damaging Het
Setd2 A G 9: 110,571,954 H1736R probably benign Het
Sidt2 A T 9: 45,952,029 D180E probably benign Het
Skint9 A T 4: 112,391,011 Y179N probably benign Het
Slc27a5 T C 7: 12,988,633 N638S probably benign Het
Slc6a4 T A 11: 77,013,309 W197R probably damaging Het
Spag17 A T 3: 100,063,333 M1278L probably benign Het
Sptbn1 T A 11: 30,142,353 I471F probably damaging Het
Teddm1a A G 1: 153,892,636 Q282R probably benign Het
Tex35 A G 1: 157,099,725 L160P probably damaging Het
Tfap2c T C 2: 172,551,518 Y118H probably damaging Het
Tpp1 T C 7: 105,746,723 Q533R probably benign Het
Ttc13 C T 8: 124,674,435 D730N probably damaging Het
Ufc1 A G 1: 171,294,802 probably benign Het
Vcpip1 A G 1: 9,747,364 W265R probably damaging Het
Wdr11 C G 7: 129,600,434 probably null Het
Xirp2 A G 2: 67,511,064 I1216M possibly damaging Het
Zswim2 A G 2: 83,916,843 probably null Het
Other mutations in Prlr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Prlr APN 15 10328324 missense probably benign 0.00
IGL00688:Prlr APN 15 10322381 unclassified probably benign
IGL01527:Prlr APN 15 10329171 missense probably benign 0.28
IGL01626:Prlr APN 15 10328718 missense probably benign 0.12
IGL01660:Prlr APN 15 10317590 missense probably damaging 1.00
IGL01835:Prlr APN 15 10329043 missense probably damaging 1.00
IGL01926:Prlr APN 15 10314220 start codon destroyed probably null 0.76
IGL01952:Prlr APN 15 10328342 missense possibly damaging 0.95
IGL02306:Prlr APN 15 10328674 missense probably benign 0.05
IGL02394:Prlr APN 15 10328578 missense probably benign 0.03
IGL02430:Prlr APN 15 10325391 missense probably damaging 1.00
IGL02695:Prlr APN 15 10328365 missense probably benign 0.20
IGL02745:Prlr APN 15 10328594 missense possibly damaging 0.50
IGL03193:Prlr APN 15 10328290 missense possibly damaging 0.57
IGL03277:Prlr APN 15 10328801 missense probably benign 0.01
IGL03379:Prlr APN 15 10319317 missense possibly damaging 0.80
PIT4434001:Prlr UTSW 15 10328372 missense probably damaging 1.00
R0057:Prlr UTSW 15 10328423 missense probably damaging 0.99
R0057:Prlr UTSW 15 10328423 missense probably damaging 0.99
R0545:Prlr UTSW 15 10317566 missense probably damaging 1.00
R1236:Prlr UTSW 15 10325281 missense probably benign 0.13
R1352:Prlr UTSW 15 10328786 missense probably benign
R1524:Prlr UTSW 15 10319333 missense probably damaging 0.97
R1537:Prlr UTSW 15 10328278 splice site probably null
R1690:Prlr UTSW 15 10317590 missense probably damaging 1.00
R1773:Prlr UTSW 15 10325318 nonsense probably null
R1789:Prlr UTSW 15 10322536 missense probably benign 0.32
R2421:Prlr UTSW 15 10319257 missense probably damaging 1.00
R4518:Prlr UTSW 15 10328999 missense possibly damaging 0.53
R4621:Prlr UTSW 15 10319376 intron probably benign
R4957:Prlr UTSW 15 10319195 missense probably damaging 1.00
R5053:Prlr UTSW 15 10325385 missense probably benign 0.00
R5731:Prlr UTSW 15 10314135 missense probably benign 0.00
R5749:Prlr UTSW 15 10328718 missense probably benign 0.12
R5806:Prlr UTSW 15 10319204 missense probably damaging 1.00
R5927:Prlr UTSW 15 10322446 missense probably benign 0.42
R6170:Prlr UTSW 15 10328849 missense probably benign 0.05
R6911:Prlr UTSW 15 10329184 missense probably benign
R6935:Prlr UTSW 15 10319302 missense probably damaging 1.00
R7327:Prlr UTSW 15 10346438 missense probably benign 0.00
R7539:Prlr UTSW 15 10329023 missense probably benign 0.11
R7579:Prlr UTSW 15 10328935 missense probably benign 0.08
R7615:Prlr UTSW 15 10325924 missense probably damaging 1.00
R7651:Prlr UTSW 15 10328378 missense probably benign 0.26
R8213:Prlr UTSW 15 10329242 missense possibly damaging 0.95
Z1176:Prlr UTSW 15 10314255 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGCCAGAGAATCCTGAGGC -3'
(R):5'- AATGATAGCACTCCGTCTTTGTTG -3'

Sequencing Primer
(F):5'- GAGAATCCTGAGGCAAATATTCCTC -3'
(R):5'- GACTTTGTGAATCTCCACGTAATCTG -3'
Posted On2016-03-01