Incidental Mutation 'R4856:Nectin4'
ID373926
Institutional Source Beutler Lab
Gene Symbol Nectin4
Ensembl Gene ENSMUSG00000006411
Gene Namenectin cell adhesion molecule 4
Synonyms1200017F15Rik, Prr4, Pvrl4, nectin 4
MMRRC Submission 042467-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R4856 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location171370099-171388598 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 171384815 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 327 (V327A)
Ref Sequence ENSEMBL: ENSMUSP00000106917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006578] [ENSMUST00000056449] [ENSMUST00000094325] [ENSMUST00000111286]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006578
AA Change: V327A

PolyPhen 2 Score 0.460 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000006578
Gene: ENSMUSG00000006411
AA Change: V327A

DomainStartEndE-ValueType
IG 36 145 9.26e-8 SMART
Pfam:Ig_2 147 241 4e-4 PFAM
Pfam:C2-set_2 150 233 9e-17 PFAM
IGc2 259 321 9.78e-7 SMART
transmembrane domain 348 370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000056449
SMART Domains Protein: ENSMUSP00000059389
Gene: ENSMUSG00000048865

DomainStartEndE-ValueType
low complexity region 6 14 N/A INTRINSIC
RhoGAP 31 212 1.4e-61 SMART
Blast:RhoGAP 225 285 2e-24 BLAST
low complexity region 348 366 N/A INTRINSIC
low complexity region 367 378 N/A INTRINSIC
low complexity region 452 463 N/A INTRINSIC
low complexity region 498 510 N/A INTRINSIC
low complexity region 514 534 N/A INTRINSIC
low complexity region 667 690 N/A INTRINSIC
low complexity region 736 752 N/A INTRINSIC
low complexity region 924 940 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000094325
AA Change: V327A

PolyPhen 2 Score 0.460 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000091883
Gene: ENSMUSG00000006411
AA Change: V327A

DomainStartEndE-ValueType
IG 36 145 9.26e-8 SMART
Pfam:Ig_2 147 241 2.1e-4 PFAM
Pfam:C2-set_2 150 233 8.7e-17 PFAM
IGc2 259 321 9.78e-7 SMART
transmembrane domain 348 370 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111286
AA Change: V327A

PolyPhen 2 Score 0.460 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106917
Gene: ENSMUSG00000006411
AA Change: V327A

DomainStartEndE-ValueType
IG 100 209 9.26e-8 SMART
Pfam:C2-set_2 214 297 1.2e-16 PFAM
IGc2 323 385 9.78e-7 SMART
transmembrane domain 412 434 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135312
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194914
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nectin family. The encoded protein contains two immunoglobulin-like (Ig-like) C2-type domains and one Ig-like V-type domain. It is involved in cell adhesion through trans-homophilic and -heterophilic interactions. It is a single-pass type I membrane protein. The soluble form is produced by proteolytic cleavage at the cell surface by the metalloproteinase ADAM17/TACE. The secreted form is found in both breast tumor cell lines and breast tumor patients. Mutations in this gene are the cause of ectodermal dysplasia-syndactyly syndrome type 1, an autosomal recessive disorder. Alternatively spliced transcript variants have been found but the full-length nature of the variant has not been determined.[provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp2 G A 6: 140,644,073 probably null Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp2b4 T A 1: 133,706,780 I1177L probably benign Het
Bub3 A T 7: 131,561,568 D76V probably damaging Het
Cacna2d4 G A 6: 119,278,256 R578Q possibly damaging Het
Caprin2 A C 6: 148,873,011 S268A probably benign Het
Card6 T C 15: 5,105,141 probably null Het
Cdk13 A G 13: 17,719,734 S1103P probably benign Het
Cfap221 T C 1: 119,934,204 T614A probably damaging Het
Cfap221 T A 1: 119,984,758 Y133F probably damaging Het
Clcc1 A G 3: 108,676,838 T513A probably benign Het
Clec4g T A 8: 3,716,419 probably benign Het
Cntln A C 4: 84,971,229 E316D probably benign Het
Cpne2 T A 8: 94,563,964 D392E probably benign Het
Cry1 G T 10: 85,148,770 P147T probably damaging Het
Cyp4a29 T C 4: 115,252,881 V440A probably benign Het
Ddx46 A G 13: 55,638,199 D64G unknown Het
Dhx34 A G 7: 16,215,442 S354P possibly damaging Het
Ecm2 A T 13: 49,522,787 I327F possibly damaging Het
Elavl3 T C 9: 22,026,318 K189E possibly damaging Het
Enam A T 5: 88,488,734 R82* probably null Het
Erf A G 7: 25,246,211 V45A probably damaging Het
Fat3 T A 9: 16,021,330 I1436F probably benign Het
Flnc T C 6: 29,447,890 Y1231H probably damaging Het
Ggta1 T A 2: 35,402,791 H180L possibly damaging Het
Gm13103 G T 4: 143,853,303 R486L probably benign Het
Grin2c T C 11: 115,260,790 T115A probably damaging Het
H6pd C T 4: 149,982,778 V384M possibly damaging Het
Hba-x A G 11: 32,277,008 E39G probably benign Het
Hnrnpul2 C T 19: 8,829,827 P618S probably benign Het
Hpse2 C T 19: 42,788,957 R590H probably damaging Het
Ighv1-54 C A 12: 115,193,803 G75C probably damaging Het
Ighv8-11 C A 12: 115,567,154 R118L possibly damaging Het
Iqcm A T 8: 75,888,600 R436S possibly damaging Het
Islr T C 9: 58,157,606 D206G probably damaging Het
Itih1 A G 14: 30,936,701 probably null Het
Jam2 G A 16: 84,801,602 D34N probably benign Het
Klhl14 A T 18: 21,557,972 probably null Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Lrrc66 A G 5: 73,608,567 F378L probably benign Het
Map10 T A 8: 125,670,692 Y275N probably damaging Het
Mpi T C 9: 57,545,307 Y314C probably damaging Het
Mpp3 A G 11: 102,025,136 Y55H probably benign Het
Nlrp12 T A 7: 3,240,442 D480V probably damaging Het
Nolc1 GAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,083,155 probably benign Het
Notch2 A T 3: 98,102,419 Y554F probably damaging Het
Nrsn2 T C 2: 152,369,611 K167E probably benign Het
Olfr147 A T 9: 38,403,468 N195I probably damaging Het
Olfr1472 T C 19: 13,454,521 probably null Het
Olfr1501 T A 19: 13,838,279 E298V probably damaging Het
Olfr695 T A 7: 106,873,970 I92F probably damaging Het
Olfr761 A T 17: 37,952,071 S318T probably benign Het
Olr1 T A 6: 129,493,596 K203* probably null Het
Osbpl9 T C 4: 109,068,367 N485S probably benign Het
Pbk T A 14: 65,815,201 H164Q probably damaging Het
Pfn2 G T 3: 57,847,453 N10K probably damaging Het
Pik3ca A G 3: 32,437,163 D133G probably damaging Het
Prl6a1 A T 13: 27,319,000 D193V probably damaging Het
Rad21 G T 15: 51,968,500 P395Q probably damaging Het
Reps1 T A 10: 18,123,625 I720N probably damaging Het
Rpn2 T C 2: 157,318,044 probably null Het
Rreb1 G A 13: 37,931,058 V798M possibly damaging Het
Sardh C T 2: 27,244,477 R9H probably benign Het
Scgb3a2 C T 18: 43,766,754 P36S probably damaging Het
Scn10a C A 9: 119,694,309 G6V possibly damaging Het
Scn10a C T 9: 119,694,310 G6R possibly damaging Het
Scn3a T C 2: 65,461,032 D1790G probably damaging Het
Sec24b A T 3: 129,983,970 H1226Q probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc12a3 G A 8: 94,351,810 probably null Het
Slitrk6 T C 14: 110,751,883 T131A probably damaging Het
Spata1 C G 3: 146,469,774 D326H probably damaging Het
Tcrg-V4 T C 13: 19,185,066 V29A probably benign Het
Tex52 A T 6: 128,384,988 probably null Het
Tma16 A C 8: 66,481,477 C75W probably damaging Het
Tmem67 G A 4: 12,089,416 probably benign Het
Trmt10a A T 3: 138,148,385 K75* probably null Het
Ttc3 T C 16: 94,390,283 V228A probably benign Het
Ttn T C 2: 76,731,300 D28954G probably damaging Het
Uggt2 A G 14: 119,035,964 probably null Het
Vars T A 17: 35,015,726 V1177E probably benign Het
Vmn1r59 T C 7: 5,454,533 D76G possibly damaging Het
Vmn2r114 G T 17: 23,308,034 A508E probably benign Het
Vps41 G A 13: 18,829,255 V348M probably damaging Het
Zbtb43 T C 2: 33,453,932 H427R probably damaging Het
Other mutations in Nectin4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Nectin4 APN 1 171384686 missense probably damaging 1.00
IGL01558:Nectin4 APN 1 171384689 missense probably benign 0.00
IGL02608:Nectin4 APN 1 171384773 missense probably benign 0.05
R2047:Nectin4 UTSW 1 171385152 missense possibly damaging 0.61
R2203:Nectin4 UTSW 1 171386229 missense possibly damaging 0.78
R2518:Nectin4 UTSW 1 171380208 missense probably benign 0.00
R4125:Nectin4 UTSW 1 171385733 missense probably benign 0.02
R4708:Nectin4 UTSW 1 171385146 missense probably benign 0.02
R4886:Nectin4 UTSW 1 171384815 missense possibly damaging 0.46
R5222:Nectin4 UTSW 1 171385257 splice site probably null
R5264:Nectin4 UTSW 1 171383705 missense probably benign 0.00
R5661:Nectin4 UTSW 1 171385170 missense probably damaging 1.00
R6466:Nectin4 UTSW 1 171386753 missense probably damaging 1.00
R6714:Nectin4 UTSW 1 171370650 start gained probably benign
R7272:Nectin4 UTSW 1 171386644 missense probably damaging 1.00
R7302:Nectin4 UTSW 1 171386635 nonsense probably null
R7318:Nectin4 UTSW 1 171380463 missense probably benign 0.16
R7669:Nectin4 UTSW 1 171380259 missense probably benign 0.00
R7732:Nectin4 UTSW 1 171386678 missense probably benign 0.00
R7751:Nectin4 UTSW 1 171383758 critical splice donor site probably null
R7912:Nectin4 UTSW 1 171380373 missense possibly damaging 0.86
R7993:Nectin4 UTSW 1 171383754 missense probably damaging 1.00
R8029:Nectin4 UTSW 1 171386687 missense probably benign 0.04
R8306:Nectin4 UTSW 1 171383757 missense probably null 1.00
R8314:Nectin4 UTSW 1 171384727 missense probably benign 0.44
R8475:Nectin4 UTSW 1 171384712 nonsense probably null
R8807:Nectin4 UTSW 1 171383714 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTAGAATCATGTGGGATGGC -3'
(R):5'- TGGGACAGACACATCCACAG -3'

Sequencing Primer
(F):5'- GGATCTTCCCCCAAGTGTGTG -3'
(R):5'- GCTACCCACTCAGCTTAATCC -3'
Posted On2016-03-01