Incidental Mutation 'R4856:Tmem67'
ID373941
Institutional Source Beutler Lab
Gene Symbol Tmem67
Ensembl Gene ENSMUSG00000049488
Gene Nametransmembrane protein 67
Synonymsb2b1291.1Clo, 5330408M12Rik, b2b1163.1Clo
MMRRC Submission 042467-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4856 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location12039355-12090020 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 12089416 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000050686] [ENSMUST00000063839] [ENSMUST00000095143] [ENSMUST00000108293]
Predicted Effect probably benign
Transcript: ENSMUST00000050686
SMART Domains Protein: ENSMUSP00000052644
Gene: ENSMUSG00000049488

DomainStartEndE-ValueType
low complexity region 17 23 N/A INTRINSIC
Pfam:Meckelin 166 995 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063839
SMART Domains Protein: ENSMUSP00000066311
Gene: ENSMUSG00000052137

DomainStartEndE-ValueType
RRM 4 72 2.1e-1 SMART
low complexity region 115 125 N/A INTRINSIC
RRM 155 225 5.59e-4 SMART
RRM 284 355 4.87e-4 SMART
RRM 402 474 2.28e-9 SMART
RRM 759 832 7.49e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095143
SMART Domains Protein: ENSMUSP00000092765
Gene: ENSMUSG00000052137

DomainStartEndE-ValueType
RRM 4 72 2.1e-1 SMART
low complexity region 115 125 N/A INTRINSIC
RRM 155 225 5.59e-4 SMART
RRM 284 355 4.87e-4 SMART
RRM 402 474 2.28e-9 SMART
RRM 759 832 7.49e-5 SMART
Predicted Effect unknown
Transcript: ENSMUST00000108293
AA Change: L5F
SMART Domains Protein: ENSMUSP00000103928
Gene: ENSMUSG00000049488
AA Change: L5F

DomainStartEndE-ValueType
low complexity region 83 89 N/A INTRINSIC
Pfam:Meckelin 236 1061 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131145
SMART Domains Protein: ENSMUSP00000115154
Gene: ENSMUSG00000049488

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146140
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151859
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to the primary cilium and to the plasma membrane. The gene functions in centriole migration to the apical membrane and formation of the primary cilium. Multiple transcript variants encoding different isoforms have been found for this gene. Defects in this gene are a cause of Meckel syndrome type 3 (MKS3) and Joubert syndrome type 6 (JBTS6). [provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit neonatal/postanal lethality, kidney cysts, and Meckel-Gruber or Joubert syndrome-like phenotypes depending on the filial generation of the backcross to C57BL/6J. Mice homozygous for an ENU-induced allele exhibit cardiovascular defects and cystic kidney. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp2 G A 6: 140,644,073 probably null Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp2b4 T A 1: 133,706,780 I1177L probably benign Het
Bub3 A T 7: 131,561,568 D76V probably damaging Het
Cacna2d4 G A 6: 119,278,256 R578Q possibly damaging Het
Caprin2 A C 6: 148,873,011 S268A probably benign Het
Card6 T C 15: 5,105,141 probably null Het
Cdk13 A G 13: 17,719,734 S1103P probably benign Het
Cfap221 T C 1: 119,934,204 T614A probably damaging Het
Cfap221 T A 1: 119,984,758 Y133F probably damaging Het
Clcc1 A G 3: 108,676,838 T513A probably benign Het
Clec4g T A 8: 3,716,419 probably benign Het
Cntln A C 4: 84,971,229 E316D probably benign Het
Cpne2 T A 8: 94,563,964 D392E probably benign Het
Cry1 G T 10: 85,148,770 P147T probably damaging Het
Cyp4a29 T C 4: 115,252,881 V440A probably benign Het
Ddx46 A G 13: 55,638,199 D64G unknown Het
Dhx34 A G 7: 16,215,442 S354P possibly damaging Het
Ecm2 A T 13: 49,522,787 I327F possibly damaging Het
Elavl3 T C 9: 22,026,318 K189E possibly damaging Het
Enam A T 5: 88,488,734 R82* probably null Het
Erf A G 7: 25,246,211 V45A probably damaging Het
Fat3 T A 9: 16,021,330 I1436F probably benign Het
Flnc T C 6: 29,447,890 Y1231H probably damaging Het
Ggta1 T A 2: 35,402,791 H180L possibly damaging Het
Gm13103 G T 4: 143,853,303 R486L probably benign Het
Grin2c T C 11: 115,260,790 T115A probably damaging Het
H6pd C T 4: 149,982,778 V384M possibly damaging Het
Hba-x A G 11: 32,277,008 E39G probably benign Het
Hnrnpul2 C T 19: 8,829,827 P618S probably benign Het
Hpse2 C T 19: 42,788,957 R590H probably damaging Het
Ighv1-54 C A 12: 115,193,803 G75C probably damaging Het
Ighv8-11 C A 12: 115,567,154 R118L possibly damaging Het
Iqcm A T 8: 75,888,600 R436S possibly damaging Het
Islr T C 9: 58,157,606 D206G probably damaging Het
Itih1 A G 14: 30,936,701 probably null Het
Jam2 G A 16: 84,801,602 D34N probably benign Het
Klhl14 A T 18: 21,557,972 probably null Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Lrrc66 A G 5: 73,608,567 F378L probably benign Het
Map10 T A 8: 125,670,692 Y275N probably damaging Het
Mpi T C 9: 57,545,307 Y314C probably damaging Het
Mpp3 A G 11: 102,025,136 Y55H probably benign Het
Nectin4 T C 1: 171,384,815 V327A possibly damaging Het
Nlrp12 T A 7: 3,240,442 D480V probably damaging Het
Nolc1 GAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,083,155 probably benign Het
Notch2 A T 3: 98,102,419 Y554F probably damaging Het
Nrsn2 T C 2: 152,369,611 K167E probably benign Het
Olfr147 A T 9: 38,403,468 N195I probably damaging Het
Olfr1472 T C 19: 13,454,521 probably null Het
Olfr1501 T A 19: 13,838,279 E298V probably damaging Het
Olfr695 T A 7: 106,873,970 I92F probably damaging Het
Olfr761 A T 17: 37,952,071 S318T probably benign Het
Olr1 T A 6: 129,493,596 K203* probably null Het
Osbpl9 T C 4: 109,068,367 N485S probably benign Het
Pbk T A 14: 65,815,201 H164Q probably damaging Het
Pfn2 G T 3: 57,847,453 N10K probably damaging Het
Pik3ca A G 3: 32,437,163 D133G probably damaging Het
Prl6a1 A T 13: 27,319,000 D193V probably damaging Het
Rad21 G T 15: 51,968,500 P395Q probably damaging Het
Reps1 T A 10: 18,123,625 I720N probably damaging Het
Rpn2 T C 2: 157,318,044 probably null Het
Rreb1 G A 13: 37,931,058 V798M possibly damaging Het
Sardh C T 2: 27,244,477 R9H probably benign Het
Scgb3a2 C T 18: 43,766,754 P36S probably damaging Het
Scn10a C A 9: 119,694,309 G6V possibly damaging Het
Scn10a C T 9: 119,694,310 G6R possibly damaging Het
Scn3a T C 2: 65,461,032 D1790G probably damaging Het
Sec24b A T 3: 129,983,970 H1226Q probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc12a3 G A 8: 94,351,810 probably null Het
Slitrk6 T C 14: 110,751,883 T131A probably damaging Het
Spata1 C G 3: 146,469,774 D326H probably damaging Het
Tcrg-V4 T C 13: 19,185,066 V29A probably benign Het
Tex52 A T 6: 128,384,988 probably null Het
Tma16 A C 8: 66,481,477 C75W probably damaging Het
Trmt10a A T 3: 138,148,385 K75* probably null Het
Ttc3 T C 16: 94,390,283 V228A probably benign Het
Ttn T C 2: 76,731,300 D28954G probably damaging Het
Uggt2 A G 14: 119,035,964 probably null Het
Vars T A 17: 35,015,726 V1177E probably benign Het
Vmn1r59 T C 7: 5,454,533 D76G possibly damaging Het
Vmn2r114 G T 17: 23,308,034 A508E probably benign Het
Vps41 G A 13: 18,829,255 V348M probably damaging Het
Zbtb43 T C 2: 33,453,932 H427R probably damaging Het
Other mutations in Tmem67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Tmem67 APN 4 12061826 missense probably damaging 0.98
IGL00768:Tmem67 APN 4 12055029 critical splice donor site probably null
IGL00813:Tmem67 APN 4 12058587 splice site probably benign
IGL01070:Tmem67 APN 4 12054750 missense probably benign 0.20
IGL01088:Tmem67 APN 4 12063126 missense probably damaging 1.00
IGL01353:Tmem67 APN 4 12079895 missense probably damaging 1.00
IGL01490:Tmem67 APN 4 12057422 splice site probably benign
IGL01885:Tmem67 APN 4 12057389 missense probably damaging 1.00
IGL02061:Tmem67 APN 4 12053526 missense probably damaging 1.00
IGL02151:Tmem67 APN 4 12068882 missense probably benign 0.35
IGL02166:Tmem67 APN 4 12047313 missense possibly damaging 0.90
IGL02243:Tmem67 APN 4 12070584 missense possibly damaging 0.93
IGL02517:Tmem67 APN 4 12069463 missense possibly damaging 0.67
IGL02736:Tmem67 APN 4 12045789 splice site probably null
R0282:Tmem67 UTSW 4 12087930 missense probably damaging 0.99
R0514:Tmem67 UTSW 4 12089317 missense probably benign
R1221:Tmem67 UTSW 4 12045871 missense possibly damaging 0.92
R1301:Tmem67 UTSW 4 12089400 unclassified probably benign
R1581:Tmem67 UTSW 4 12047814 missense probably damaging 1.00
R1680:Tmem67 UTSW 4 12087840 missense probably benign 0.00
R1804:Tmem67 UTSW 4 12045789 splice site probably null
R2174:Tmem67 UTSW 4 12063730 nonsense probably null
R2191:Tmem67 UTSW 4 12069413 critical splice donor site probably null
R2246:Tmem67 UTSW 4 12040651 missense probably damaging 1.00
R2566:Tmem67 UTSW 4 12079918 missense probably damaging 0.99
R3409:Tmem67 UTSW 4 12073952 missense probably benign 0.00
R3410:Tmem67 UTSW 4 12073952 missense probably benign 0.00
R4078:Tmem67 UTSW 4 12040633 critical splice donor site probably null
R4282:Tmem67 UTSW 4 12073922 missense probably damaging 0.99
R4429:Tmem67 UTSW 4 12051473 missense possibly damaging 0.52
R4430:Tmem67 UTSW 4 12051473 missense possibly damaging 0.52
R4431:Tmem67 UTSW 4 12051473 missense possibly damaging 0.52
R4734:Tmem67 UTSW 4 12063158 missense probably benign 0.00
R4865:Tmem67 UTSW 4 12070262 missense probably benign 0.01
R5056:Tmem67 UTSW 4 12070471 missense probably benign 0.29
R5575:Tmem67 UTSW 4 12047886 missense possibly damaging 0.93
R5614:Tmem67 UTSW 4 12061755 missense possibly damaging 0.54
R6030:Tmem67 UTSW 4 12063799 missense probably benign 0.01
R6030:Tmem67 UTSW 4 12063799 missense probably benign 0.01
R6182:Tmem67 UTSW 4 12051402 missense probably benign 0.05
R6562:Tmem67 UTSW 4 12053445 critical splice donor site probably null
R6574:Tmem67 UTSW 4 12063086 missense possibly damaging 0.70
R6696:Tmem67 UTSW 4 12061754 critical splice donor site probably null
R6824:Tmem67 UTSW 4 12051449 missense probably damaging 1.00
R7028:Tmem67 UTSW 4 12075484 missense probably benign 0.12
R7174:Tmem67 UTSW 4 12077337 missense possibly damaging 0.82
R7369:Tmem67 UTSW 4 12053535 missense probably damaging 1.00
R7638:Tmem67 UTSW 4 12079883 missense probably benign 0.17
R7671:Tmem67 UTSW 4 12063698 missense probably benign 0.00
R7736:Tmem67 UTSW 4 12053455 missense probably benign 0.09
R7920:Tmem67 UTSW 4 12089284 critical splice donor site probably null
R7981:Tmem67 UTSW 4 12070592 missense probably damaging 1.00
R8005:Tmem67 UTSW 4 12047821 missense probably damaging 1.00
R8086:Tmem67 UTSW 4 12040738 missense probably damaging 1.00
R8196:Tmem67 UTSW 4 12075661 missense probably benign 0.00
R8344:Tmem67 UTSW 4 12058576 missense probably benign 0.00
R8350:Tmem67 UTSW 4 12087891 missense probably benign 0.07
R8450:Tmem67 UTSW 4 12087891 missense probably benign 0.07
Z1176:Tmem67 UTSW 4 12087983 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCCTAGAAATAGAGCATGCAC -3'
(R):5'- GTCAAGATCCCAGGAAGCTCAC -3'

Sequencing Primer
(F):5'- GCCTAGAAATAGAGCATGCACAAAAC -3'
(R):5'- CAGGAAGCTCACTCGCC -3'
Posted On2016-03-01