Incidental Mutation 'R4856:H6pd'
ID373947
Institutional Source Beutler Lab
Gene Symbol H6pd
Ensembl Gene ENSMUSG00000028980
Gene Namehexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)
SynonymsGpd-1, Gpd1, G6pd1
MMRRC Submission 042467-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R4856 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location149979475-150009023 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 149982778 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 384 (V384M)
Ref Sequence ENSEMBL: ENSMUSP00000081134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030830] [ENSMUST00000084117]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030830
AA Change: V392M

PolyPhen 2 Score 0.475 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000030830
Gene: ENSMUSG00000028980
AA Change: V392M

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:G6PD_N 34 218 1.6e-41 PFAM
Pfam:G6PD_C 220 523 3.2e-58 PFAM
Pfam:Glucosamine_iso 564 788 8.2e-66 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000084117
AA Change: V384M

PolyPhen 2 Score 0.475 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000081134
Gene: ENSMUSG00000028980
AA Change: V384M

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:G6PD_N 26 210 8.6e-39 PFAM
Pfam:G6PD_C 212 387 3.6e-42 PFAM
Pfam:Glucosamine_iso 561 758 9.9e-62 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are 2 forms of glucose-6-phosphate dehydrogenase. G form is X-linked and H form, encoded by this gene, is autosomally linked. This H form shows activity with other hexose-6-phosphates, especially galactose-6-phosphate, whereas the G form is specific for glucose-6-phosphate. Both forms are present in most tissues, but H form is not found in red cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show enlarged adrenal glands, reduced plasma corticosterone levels and altered 11 beta-hydroxysteroid dehydrogenase type 1 enzyme activity. Treatment with 11-dehydrocorticosterone fails to inhibit glucose-stimulatedinsulin secretion in pancreatic islets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp2 G A 6: 140,644,073 probably null Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp2b4 T A 1: 133,706,780 I1177L probably benign Het
Bub3 A T 7: 131,561,568 D76V probably damaging Het
Cacna2d4 G A 6: 119,278,256 R578Q possibly damaging Het
Caprin2 A C 6: 148,873,011 S268A probably benign Het
Card6 T C 15: 5,105,141 probably null Het
Cdk13 A G 13: 17,719,734 S1103P probably benign Het
Cfap221 T C 1: 119,934,204 T614A probably damaging Het
Cfap221 T A 1: 119,984,758 Y133F probably damaging Het
Clcc1 A G 3: 108,676,838 T513A probably benign Het
Clec4g T A 8: 3,716,419 probably benign Het
Cntln A C 4: 84,971,229 E316D probably benign Het
Cpne2 T A 8: 94,563,964 D392E probably benign Het
Cry1 G T 10: 85,148,770 P147T probably damaging Het
Cyp4a29 T C 4: 115,252,881 V440A probably benign Het
Ddx46 A G 13: 55,638,199 D64G unknown Het
Dhx34 A G 7: 16,215,442 S354P possibly damaging Het
Ecm2 A T 13: 49,522,787 I327F possibly damaging Het
Elavl3 T C 9: 22,026,318 K189E possibly damaging Het
Enam A T 5: 88,488,734 R82* probably null Het
Erf A G 7: 25,246,211 V45A probably damaging Het
Fat3 T A 9: 16,021,330 I1436F probably benign Het
Flnc T C 6: 29,447,890 Y1231H probably damaging Het
Ggta1 T A 2: 35,402,791 H180L possibly damaging Het
Gm13103 G T 4: 143,853,303 R486L probably benign Het
Grin2c T C 11: 115,260,790 T115A probably damaging Het
Hba-x A G 11: 32,277,008 E39G probably benign Het
Hnrnpul2 C T 19: 8,829,827 P618S probably benign Het
Hpse2 C T 19: 42,788,957 R590H probably damaging Het
Ighv1-54 C A 12: 115,193,803 G75C probably damaging Het
Ighv8-11 C A 12: 115,567,154 R118L possibly damaging Het
Iqcm A T 8: 75,888,600 R436S possibly damaging Het
Islr T C 9: 58,157,606 D206G probably damaging Het
Itih1 A G 14: 30,936,701 probably null Het
Jam2 G A 16: 84,801,602 D34N probably benign Het
Klhl14 A T 18: 21,557,972 probably null Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Lrrc66 A G 5: 73,608,567 F378L probably benign Het
Map10 T A 8: 125,670,692 Y275N probably damaging Het
Mpi T C 9: 57,545,307 Y314C probably damaging Het
Mpp3 A G 11: 102,025,136 Y55H probably benign Het
Nectin4 T C 1: 171,384,815 V327A possibly damaging Het
Nlrp12 T A 7: 3,240,442 D480V probably damaging Het
Nolc1 GAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,083,155 probably benign Het
Notch2 A T 3: 98,102,419 Y554F probably damaging Het
Nrsn2 T C 2: 152,369,611 K167E probably benign Het
Olfr147 A T 9: 38,403,468 N195I probably damaging Het
Olfr1472 T C 19: 13,454,521 probably null Het
Olfr1501 T A 19: 13,838,279 E298V probably damaging Het
Olfr695 T A 7: 106,873,970 I92F probably damaging Het
Olfr761 A T 17: 37,952,071 S318T probably benign Het
Olr1 T A 6: 129,493,596 K203* probably null Het
Osbpl9 T C 4: 109,068,367 N485S probably benign Het
Pbk T A 14: 65,815,201 H164Q probably damaging Het
Pfn2 G T 3: 57,847,453 N10K probably damaging Het
Pik3ca A G 3: 32,437,163 D133G probably damaging Het
Prl6a1 A T 13: 27,319,000 D193V probably damaging Het
Rad21 G T 15: 51,968,500 P395Q probably damaging Het
Reps1 T A 10: 18,123,625 I720N probably damaging Het
Rpn2 T C 2: 157,318,044 probably null Het
Rreb1 G A 13: 37,931,058 V798M possibly damaging Het
Sardh C T 2: 27,244,477 R9H probably benign Het
Scgb3a2 C T 18: 43,766,754 P36S probably damaging Het
Scn10a C A 9: 119,694,309 G6V possibly damaging Het
Scn10a C T 9: 119,694,310 G6R possibly damaging Het
Scn3a T C 2: 65,461,032 D1790G probably damaging Het
Sec24b A T 3: 129,983,970 H1226Q probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc12a3 G A 8: 94,351,810 probably null Het
Slitrk6 T C 14: 110,751,883 T131A probably damaging Het
Spata1 C G 3: 146,469,774 D326H probably damaging Het
Tcrg-V4 T C 13: 19,185,066 V29A probably benign Het
Tex52 A T 6: 128,384,988 probably null Het
Tma16 A C 8: 66,481,477 C75W probably damaging Het
Tmem67 G A 4: 12,089,416 probably benign Het
Trmt10a A T 3: 138,148,385 K75* probably null Het
Ttc3 T C 16: 94,390,283 V228A probably benign Het
Ttn T C 2: 76,731,300 D28954G probably damaging Het
Uggt2 A G 14: 119,035,964 probably null Het
Vars T A 17: 35,015,726 V1177E probably benign Het
Vmn1r59 T C 7: 5,454,533 D76G possibly damaging Het
Vmn2r114 G T 17: 23,308,034 A508E probably benign Het
Vps41 G A 13: 18,829,255 V348M probably damaging Het
Zbtb43 T C 2: 33,453,932 H427R probably damaging Het
Other mutations in H6pd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:H6pd APN 4 149994468 critical splice donor site probably null
IGL01450:H6pd APN 4 149984118 missense probably damaging 1.00
IGL01913:H6pd APN 4 149994463 unclassified probably benign
IGL01914:H6pd APN 4 149994463 unclassified probably benign
dryer UTSW 4 149982865 missense probably damaging 1.00
herr UTSW 4 149983902 critical splice donor site probably null
R0402:H6pd UTSW 4 149996316 missense probably damaging 1.00
R0486:H6pd UTSW 4 149982936 splice site probably benign
R0548:H6pd UTSW 4 149981616 missense probably damaging 1.00
R0690:H6pd UTSW 4 149982573 missense possibly damaging 0.93
R1165:H6pd UTSW 4 149995956 missense possibly damaging 0.95
R1298:H6pd UTSW 4 149982514 missense probably benign 0.01
R1331:H6pd UTSW 4 149982415 missense probably benign 0.28
R1581:H6pd UTSW 4 149982514 missense possibly damaging 0.94
R1781:H6pd UTSW 4 149995931 missense probably damaging 1.00
R1791:H6pd UTSW 4 149981673 missense probably damaging 0.97
R1840:H6pd UTSW 4 149982050 missense possibly damaging 0.55
R2290:H6pd UTSW 4 149981881 missense probably damaging 1.00
R3889:H6pd UTSW 4 149995773 missense possibly damaging 0.67
R4432:H6pd UTSW 4 149995758 missense probably damaging 1.00
R4576:H6pd UTSW 4 149994476 missense probably damaging 0.99
R4629:H6pd UTSW 4 149996346 missense probably benign 0.10
R4886:H6pd UTSW 4 149982778 missense possibly damaging 0.47
R4951:H6pd UTSW 4 149981587 missense probably damaging 1.00
R5124:H6pd UTSW 4 149982055 missense possibly damaging 0.57
R5337:H6pd UTSW 4 149981784 missense probably benign 0.02
R5408:H6pd UTSW 4 149982865 missense probably damaging 1.00
R5474:H6pd UTSW 4 149996089 missense probably damaging 1.00
R6266:H6pd UTSW 4 149995957 missense probably benign 0.32
R6476:H6pd UTSW 4 149982727 missense probably damaging 0.99
R6725:H6pd UTSW 4 149996358 missense probably damaging 1.00
R6733:H6pd UTSW 4 149985121 intron probably null
R6785:H6pd UTSW 4 149982790 missense possibly damaging 0.50
R6853:H6pd UTSW 4 149982462 missense probably benign 0.00
R6921:H6pd UTSW 4 149982051 missense probably damaging 0.99
R7258:H6pd UTSW 4 149996362 missense probably benign 0.09
R7269:H6pd UTSW 4 149982912 missense probably benign 0.00
R7326:H6pd UTSW 4 149996350 missense probably benign 0.00
R7348:H6pd UTSW 4 149983902 critical splice donor site probably null
R7488:H6pd UTSW 4 149982636 missense probably benign
R7512:H6pd UTSW 4 149995948 missense probably benign 0.00
R7684:H6pd UTSW 4 149996062 missense probably benign
R7704:H6pd UTSW 4 149982903 missense probably benign 0.45
X0020:H6pd UTSW 4 149982798 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCGGCAGTGGAAGATGTGC -3'
(R):5'- TGTCACTCTCAGGCTGTGATG -3'

Sequencing Primer
(F):5'- CCTGTAGGCGTAGTAATCAGAC -3'
(R):5'- ACTCTCAGGCTGTGATGTCTGC -3'
Posted On2016-03-01