Mutagenetix > Incidental Mutation

Incidental Mutation 'R4856:Shroom3'

373950

Institutional Source

Beutler Lab

Gene Symbol

Shroom3

Ensembl Gene

ENSMUSG00000029381

Gene Name

shroom family member 3

Synonyms

D5Ertd287e, Shrm3, Shrm

MMRRC Submission

042467-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4856 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

92683435-92965318 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 92943086 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 1151 (V1151F)

Ref Sequence

ENSEMBL: ENSMUSP00000153516 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113051] [ENSMUST00000113054] [ENSMUST00000113055] [ENSMUST00000168878] [ENSMUST00000172706] [ENSMUST00000225438]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000113051
AA Change: V1057F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000108674
Gene: ENSMUSG00000029381
AA Change: V1057F

Domain	Start	End	E-Value	Type
low complexity region	16	27	N/A	INTRINSIC
low complexity region	83	93	N/A	INTRINSIC
low complexity region	572	586	N/A	INTRINSIC
low complexity region	621	639	N/A	INTRINSIC
low complexity region	685	704	N/A	INTRINSIC
Pfam:ASD1	706	885	2.3e-65	PFAM
low complexity region	939	952	N/A	INTRINSIC
low complexity region	1132	1143	N/A	INTRINSIC
low complexity region	1172	1184	N/A	INTRINSIC
low complexity region	1274	1288	N/A	INTRINSIC
low complexity region	1333	1345	N/A	INTRINSIC
Pfam:ASD2	1478	1765	3.1e-107	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000113054
AA Change: V1057F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000108677
Gene: ENSMUSG00000029381
AA Change: V1057F

Domain	Start	End	E-Value	Type
low complexity region	16	27	N/A	INTRINSIC
low complexity region	83	93	N/A	INTRINSIC
low complexity region	572	586	N/A	INTRINSIC
low complexity region	621	639	N/A	INTRINSIC
low complexity region	685	704	N/A	INTRINSIC
Pfam:ASD1	706	885	2.3e-65	PFAM
low complexity region	939	952	N/A	INTRINSIC
low complexity region	1132	1143	N/A	INTRINSIC
low complexity region	1172	1184	N/A	INTRINSIC
low complexity region	1274	1288	N/A	INTRINSIC
low complexity region	1333	1345	N/A	INTRINSIC
Pfam:ASD2	1478	1765	3.1e-107	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000113055
AA Change: V1232F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000108678
Gene: ENSMUSG00000029381
AA Change: V1232F

Domain	Start	End	E-Value	Type
PDZ	35	109	5.81e-11	SMART
low complexity region	191	202	N/A	INTRINSIC
low complexity region	258	268	N/A	INTRINSIC
low complexity region	747	761	N/A	INTRINSIC
low complexity region	796	814	N/A	INTRINSIC
low complexity region	860	879	N/A	INTRINSIC
Pfam:ASD1	882	1060	1e-57	PFAM
low complexity region	1114	1127	N/A	INTRINSIC
low complexity region	1307	1318	N/A	INTRINSIC
low complexity region	1347	1359	N/A	INTRINSIC
low complexity region	1449	1463	N/A	INTRINSIC
low complexity region	1508	1520	N/A	INTRINSIC
Pfam:ASD2	1654	1940	9.9e-112	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000168878
AA Change: V1101F

SMART Domains

Protein: ENSMUSP00000130419
Gene: ENSMUSG00000029381
AA Change: V1101F

Domain	Start	End	E-Value	Type
PDZ	35	109	5.81e-11	SMART
low complexity region	191	202	N/A	INTRINSIC
low complexity region	258	268	N/A	INTRINSIC
low complexity region	747	761	N/A	INTRINSIC
low complexity region	796	814	N/A	INTRINSIC
low complexity region	860	879	N/A	INTRINSIC
low complexity region	983	996	N/A	INTRINSIC
low complexity region	1176	1187	N/A	INTRINSIC
low complexity region	1216	1228	N/A	INTRINSIC
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1377	1389	N/A	INTRINSIC
Pfam:ASD2	1522	1809	8.9e-108	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000172706

SMART Domains

Protein: ENSMUSP00000133690
Gene: ENSMUSG00000029381

Domain	Start	End	E-Value	Type
low complexity region	16	27	N/A	INTRINSIC
low complexity region	83	93	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200869

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201800

Predicted Effect

probably damaging
Transcript: ENSMUST00000225438
AA Change: V1151F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PDZ-domain-containing protein that belongs to a family of Shroom-related proteins. This protein may be involved in regulating cell shape in certain tissues. A similar protein in mice is required for proper neurulation. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this locus results in failed neural tube closure leading to exencephaly, acrania, facial clefting, and spina bifida. Homozygotes develop to term but die either at birth or shortly thereafter. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aebp2	G	A	6: 140,644,073		probably null	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Atp2b4	T	A	1: 133,706,780	I1177L	probably benign	Het
Bub3	A	T	7: 131,561,568	D76V	probably damaging	Het
Cacna2d4	G	A	6: 119,278,256	R578Q	possibly damaging	Het
Caprin2	A	C	6: 148,873,011	S268A	probably benign	Het
Card6	T	C	15: 5,105,141		probably null	Het
Cdk13	A	G	13: 17,719,734	S1103P	probably benign	Het
Cfap221	T	C	1: 119,934,204	T614A	probably damaging	Het
Cfap221	T	A	1: 119,984,758	Y133F	probably damaging	Het
Clcc1	A	G	3: 108,676,838	T513A	probably benign	Het
Clec4g	T	A	8: 3,716,419		probably benign	Het
Cntln	A	C	4: 84,971,229	E316D	probably benign	Het
Cpne2	T	A	8: 94,563,964	D392E	probably benign	Het
Cry1	G	T	10: 85,148,770	P147T	probably damaging	Het
Cyp4a29	T	C	4: 115,252,881	V440A	probably benign	Het
Ddx46	A	G	13: 55,638,199	D64G	unknown	Het
Dhx34	A	G	7: 16,215,442	S354P	possibly damaging	Het
Ecm2	A	T	13: 49,522,787	I327F	possibly damaging	Het
Elavl3	T	C	9: 22,026,318	K189E	possibly damaging	Het
Enam	A	T	5: 88,488,734	R82*	probably null	Het
Erf	A	G	7: 25,246,211	V45A	probably damaging	Het
Fat3	T	A	9: 16,021,330	I1436F	probably benign	Het
Flnc	T	C	6: 29,447,890	Y1231H	probably damaging	Het
Ggta1	T	A	2: 35,402,791	H180L	possibly damaging	Het
Gm13103	G	T	4: 143,853,303	R486L	probably benign	Het
Grin2c	T	C	11: 115,260,790	T115A	probably damaging	Het
H6pd	C	T	4: 149,982,778	V384M	possibly damaging	Het
Hba-x	A	G	11: 32,277,008	E39G	probably benign	Het
Hnrnpul2	C	T	19: 8,829,827	P618S	probably benign	Het
Hpse2	C	T	19: 42,788,957	R590H	probably damaging	Het
Ighv1-54	C	A	12: 115,193,803	G75C	probably damaging	Het
Ighv8-11	C	A	12: 115,567,154	R118L	possibly damaging	Het
Iqcm	A	T	8: 75,888,600	R436S	possibly damaging	Het
Islr	T	C	9: 58,157,606	D206G	probably damaging	Het
Itih1	A	G	14: 30,936,701		probably null	Het
Jam2	G	A	16: 84,801,602	D34N	probably benign	Het
Klhl14	A	T	18: 21,557,972		probably null	Het
Lama2	TTTGCGCATT	TTT	10: 27,043,643		probably null	Het
Lrrc66	A	G	5: 73,608,567	F378L	probably benign	Het
Map10	T	A	8: 125,670,692	Y275N	probably damaging	Het
Mpi	T	C	9: 57,545,307	Y314C	probably damaging	Het
Mpp3	A	G	11: 102,025,136	Y55H	probably benign	Het
Nectin4	T	C	1: 171,384,815	V327A	possibly damaging	Het
Nlrp12	T	A	7: 3,240,442	D480V	probably damaging	Het
Nolc1	GAGCAGCAGCAGCAGCAGCAGCAGCAGC	GAGCAGCAGCAGCAGCAGCAGCAGC	19: 46,083,155		probably benign	Het
Notch2	A	T	3: 98,102,419	Y554F	probably damaging	Het
Nrsn2	T	C	2: 152,369,611	K167E	probably benign	Het
Olfr147	A	T	9: 38,403,468	N195I	probably damaging	Het
Olfr1472	T	C	19: 13,454,521		probably null	Het
Olfr1501	T	A	19: 13,838,279	E298V	probably damaging	Het
Olfr695	T	A	7: 106,873,970	I92F	probably damaging	Het
Olfr761	A	T	17: 37,952,071	S318T	probably benign	Het
Olr1	T	A	6: 129,493,596	K203*	probably null	Het
Osbpl9	T	C	4: 109,068,367	N485S	probably benign	Het
Pbk	T	A	14: 65,815,201	H164Q	probably damaging	Het
Pfn2	G	T	3: 57,847,453	N10K	probably damaging	Het
Pik3ca	A	G	3: 32,437,163	D133G	probably damaging	Het
Prl6a1	A	T	13: 27,319,000	D193V	probably damaging	Het
Rad21	G	T	15: 51,968,500	P395Q	probably damaging	Het
Reps1	T	A	10: 18,123,625	I720N	probably damaging	Het
Rpn2	T	C	2: 157,318,044		probably null	Het
Rreb1	G	A	13: 37,931,058	V798M	possibly damaging	Het
Sardh	C	T	2: 27,244,477	R9H	probably benign	Het
Scgb3a2	C	T	18: 43,766,754	P36S	probably damaging	Het
Scn10a	C	A	9: 119,694,309	G6V	possibly damaging	Het
Scn10a	C	T	9: 119,694,310	G6R	possibly damaging	Het
Scn3a	T	C	2: 65,461,032	D1790G	probably damaging	Het
Sec24b	A	T	3: 129,983,970	H1226Q	probably benign	Het
Slc12a3	G	A	8: 94,351,810		probably null	Het
Slitrk6	T	C	14: 110,751,883	T131A	probably damaging	Het
Spata1	C	G	3: 146,469,774	D326H	probably damaging	Het
Tcrg-V4	T	C	13: 19,185,066	V29A	probably benign	Het
Tex52	A	T	6: 128,384,988		probably null	Het
Tma16	A	C	8: 66,481,477	C75W	probably damaging	Het
Tmem67	G	A	4: 12,089,416		probably benign	Het
Trmt10a	A	T	3: 138,148,385	K75*	probably null	Het
Ttc3	T	C	16: 94,390,283	V228A	probably benign	Het
Ttn	T	C	2: 76,731,300	D28954G	probably damaging	Het
Uggt2	A	G	14: 119,035,964		probably null	Het
Vars	T	A	17: 35,015,726	V1177E	probably benign	Het
Vmn1r59	T	C	7: 5,454,533	D76G	possibly damaging	Het
Vmn2r114	G	T	17: 23,308,034	A508E	probably benign	Het
Vps41	G	A	13: 18,829,255	V348M	probably damaging	Het
Zbtb43	T	C	2: 33,453,932	H427R	probably damaging	Het

Other mutations in Shroom3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00850:Shroom3	APN	5	92951065	missense	probably damaging	1.00
IGL01086:Shroom3	APN	5	92948452	missense	probably benign	0.01
IGL01363:Shroom3	APN	5	92940993	missense	probably benign	0.01
IGL01468:Shroom3	APN	5	92940342	missense	probably damaging	1.00
IGL01675:Shroom3	APN	5	92941680	missense	probably damaging	0.99
IGL01862:Shroom3	APN	5	92962289	missense	probably damaging	1.00
IGL01987:Shroom3	APN	5	92942189	missense	probably damaging	0.99
IGL02104:Shroom3	APN	5	92940389	missense	probably benign	0.32
IGL03248:Shroom3	APN	5	92952540	missense	probably benign	0.00
IGL03386:Shroom3	APN	5	92948483	splice site	probably benign
R0167:Shroom3	UTSW	5	92948395	splice site	probably benign
R0388:Shroom3	UTSW	5	92951293	missense	probably benign	0.39
R0395:Shroom3	UTSW	5	92780903	missense	probably damaging	1.00
R0567:Shroom3	UTSW	5	92964453	missense	possibly damaging	0.53
R1496:Shroom3	UTSW	5	92942834	missense	possibly damaging	0.69
R1772:Shroom3	UTSW	5	92940656	missense	probably damaging	0.97
R1845:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R1921:Shroom3	UTSW	5	92962365	critical splice donor site	probably null
R2059:Shroom3	UTSW	5	92683784	missense	probably damaging	1.00
R2203:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2204:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2205:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2301:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2344:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2345:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2346:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2348:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2371:Shroom3	UTSW	5	92780870	missense	probably damaging	1.00
R2435:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2829:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2830:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2831:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2897:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2898:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3079:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3080:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3433:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3729:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3730:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3735:Shroom3	UTSW	5	92964444	missense	possibly damaging	0.84
R3736:Shroom3	UTSW	5	92964444	missense	possibly damaging	0.84
R3851:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3852:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3943:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3969:Shroom3	UTSW	5	92940879	missense	probably benign	0.05
R4008:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4009:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4012:Shroom3	UTSW	5	92948483	splice site	probably benign
R4154:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4157:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4172:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4173:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4201:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4202:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4204:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4205:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4206:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4284:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4285:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4364:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4384:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4456:Shroom3	UTSW	5	92940999	missense	probably benign	0.14
R4707:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4712:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4751:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4755:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4760:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4773:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4774:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4776:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4801:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4802:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4857:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4860:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4860:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4882:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4883:Shroom3	UTSW	5	92951134	missense	probably benign	0.14
R4886:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R5262:Shroom3	UTSW	5	92964573	missense	probably damaging	1.00
R5271:Shroom3	UTSW	5	92962248	missense	probably damaging	1.00
R5719:Shroom3	UTSW	5	92943018	missense	probably benign	0.04
R5726:Shroom3	UTSW	5	92943005	missense	probably benign	0.00
R5993:Shroom3	UTSW	5	92940188	missense	probably damaging	1.00
R6078:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6079:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6138:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6153:Shroom3	UTSW	5	92964408	missense	probably damaging	0.99
R6493:Shroom3	UTSW	5	92941561	missense	probably benign	0.03
R6495:Shroom3	UTSW	5	92942069	missense	possibly damaging	0.66
R6693:Shroom3	UTSW	5	92940758	missense	possibly damaging	0.61
R6801:Shroom3	UTSW	5	92940936	missense	probably damaging	1.00
R6893:Shroom3	UTSW	5	92942204	missense	probably damaging	0.97
R6912:Shroom3	UTSW	5	92943017	missense	probably benign	0.02
R6924:Shroom3	UTSW	5	92964403	missense	probably damaging	1.00
R7083:Shroom3	UTSW	5	92964525	missense	probably damaging	1.00
R7197:Shroom3	UTSW	5	92942604	missense	probably damaging	1.00
R7366:Shroom3	UTSW	5	92964606	nonsense	probably null
R7712:Shroom3	UTSW	5	92950947	missense	probably benign	0.01
R7725:Shroom3	UTSW	5	92941653	missense	probably benign	0.19
R7728:Shroom3	UTSW	5	92683707	missense	possibly damaging	0.73
R7774:Shroom3	UTSW	5	92950489	missense	probably damaging	0.98
R7795:Shroom3	UTSW	5	92919649	missense	probably damaging	0.99
R7821:Shroom3	UTSW	5	92940846	missense	probably damaging	0.98
R7971:Shroom3	UTSW	5	92951074	missense	probably damaging	1.00
R8276:Shroom3	UTSW	5	92940480	missense	probably damaging	0.99
R8934:Shroom3	UTSW	5	92941725	missense	probably damaging	1.00
R8938:Shroom3	UTSW	5	92943071	missense	probably damaging	1.00
R9083:Shroom3	UTSW	5	92950674	missense	probably damaging	0.97
R9108:Shroom3	UTSW	5	92940116	missense	probably damaging	1.00
R9124:Shroom3	UTSW	5	92964542	missense	probably benign	0.19
R9295:Shroom3	UTSW	5	92950619	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AAGGAGCACACTCATCCGTC -3'
(R):5'- TCTTAACTGTCAGAACGGTAACC -3'

Sequencing Primer
(F):5'- GTGATCGCAGCAGCTCCTTC -3'
(R):5'- AGACATTTATATATCTTTGTGCGGG -3'

Posted On

2016-03-01