Incidental Mutation 'R4856:Nlrp12'
ID373959
Institutional Source Beutler Lab
Gene Symbol Nlrp12
Ensembl Gene ENSMUSG00000078817
Gene NameNLR family, pyrin domain containing 12
SynonymsNalp12
MMRRC Submission 042467-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R4856 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location3218784-3249740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3240442 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 480 (D480V)
Ref Sequence ENSEMBL: ENSMUSP00000104293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108653]
Predicted Effect probably damaging
Transcript: ENSMUST00000108653
AA Change: D480V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104293
Gene: ENSMUSG00000078817
AA Change: D480V

DomainStartEndE-ValueType
PYRIN 9 91 1.84e-24 SMART
FISNA 128 201 1.71e-24 SMART
Pfam:NACHT 211 381 4.2e-52 PFAM
LRR 705 732 6.78e-3 SMART
LRR 734 761 2.13e1 SMART
LRR 762 789 3.49e-5 SMART
LRR 791 818 7.02e0 SMART
LRR 819 846 6.52e-5 SMART
LRR 848 875 6.92e-1 SMART
LRR 876 903 2.47e-5 SMART
LRR 905 932 3.78e0 SMART
LRR 933 960 1.63e-5 SMART
LRR 962 989 4.9e0 SMART
LRR 990 1017 1.79e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205233
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CATERPILLER family of cytoplasmic proteins. The encoded protein, which contains an N-terminal pyrin domain, a NACHT domain, a NACHT-associated domain, and a C-terminus leucine-rich repeat region, functions as an attenuating factor of inflammation by suppressing inflammatory responses in activated monocytes. Mutations in this gene cause familial cold autoinflammatory syndrome type 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a null allele have defects in dendritic and myeloid cell migration and a decreased susceptibility to type IV hypersensitivity reactions. Mice homozygous for a second null allele display increased susceptibility to induced colitis and to chemically-induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp2 G A 6: 140,644,073 probably null Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp2b4 T A 1: 133,706,780 I1177L probably benign Het
Bub3 A T 7: 131,561,568 D76V probably damaging Het
Cacna2d4 G A 6: 119,278,256 R578Q possibly damaging Het
Caprin2 A C 6: 148,873,011 S268A probably benign Het
Card6 T C 15: 5,105,141 probably null Het
Cdk13 A G 13: 17,719,734 S1103P probably benign Het
Cfap221 T C 1: 119,934,204 T614A probably damaging Het
Cfap221 T A 1: 119,984,758 Y133F probably damaging Het
Clcc1 A G 3: 108,676,838 T513A probably benign Het
Clec4g T A 8: 3,716,419 probably benign Het
Cntln A C 4: 84,971,229 E316D probably benign Het
Cpne2 T A 8: 94,563,964 D392E probably benign Het
Cry1 G T 10: 85,148,770 P147T probably damaging Het
Cyp4a29 T C 4: 115,252,881 V440A probably benign Het
Ddx46 A G 13: 55,638,199 D64G unknown Het
Dhx34 A G 7: 16,215,442 S354P possibly damaging Het
Ecm2 A T 13: 49,522,787 I327F possibly damaging Het
Elavl3 T C 9: 22,026,318 K189E possibly damaging Het
Enam A T 5: 88,488,734 R82* probably null Het
Erf A G 7: 25,246,211 V45A probably damaging Het
Fat3 T A 9: 16,021,330 I1436F probably benign Het
Flnc T C 6: 29,447,890 Y1231H probably damaging Het
Ggta1 T A 2: 35,402,791 H180L possibly damaging Het
Gm13103 G T 4: 143,853,303 R486L probably benign Het
Grin2c T C 11: 115,260,790 T115A probably damaging Het
H6pd C T 4: 149,982,778 V384M possibly damaging Het
Hba-x A G 11: 32,277,008 E39G probably benign Het
Hnrnpul2 C T 19: 8,829,827 P618S probably benign Het
Hpse2 C T 19: 42,788,957 R590H probably damaging Het
Ighv1-54 C A 12: 115,193,803 G75C probably damaging Het
Ighv8-11 C A 12: 115,567,154 R118L possibly damaging Het
Iqcm A T 8: 75,888,600 R436S possibly damaging Het
Islr T C 9: 58,157,606 D206G probably damaging Het
Itih1 A G 14: 30,936,701 probably null Het
Jam2 G A 16: 84,801,602 D34N probably benign Het
Klhl14 A T 18: 21,557,972 probably null Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Lrrc66 A G 5: 73,608,567 F378L probably benign Het
Map10 T A 8: 125,670,692 Y275N probably damaging Het
Mpi T C 9: 57,545,307 Y314C probably damaging Het
Mpp3 A G 11: 102,025,136 Y55H probably benign Het
Nectin4 T C 1: 171,384,815 V327A possibly damaging Het
Nolc1 GAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,083,155 probably benign Het
Notch2 A T 3: 98,102,419 Y554F probably damaging Het
Nrsn2 T C 2: 152,369,611 K167E probably benign Het
Olfr147 A T 9: 38,403,468 N195I probably damaging Het
Olfr1472 T C 19: 13,454,521 probably null Het
Olfr1501 T A 19: 13,838,279 E298V probably damaging Het
Olfr695 T A 7: 106,873,970 I92F probably damaging Het
Olfr761 A T 17: 37,952,071 S318T probably benign Het
Olr1 T A 6: 129,493,596 K203* probably null Het
Osbpl9 T C 4: 109,068,367 N485S probably benign Het
Pbk T A 14: 65,815,201 H164Q probably damaging Het
Pfn2 G T 3: 57,847,453 N10K probably damaging Het
Pik3ca A G 3: 32,437,163 D133G probably damaging Het
Prl6a1 A T 13: 27,319,000 D193V probably damaging Het
Rad21 G T 15: 51,968,500 P395Q probably damaging Het
Reps1 T A 10: 18,123,625 I720N probably damaging Het
Rpn2 T C 2: 157,318,044 probably null Het
Rreb1 G A 13: 37,931,058 V798M possibly damaging Het
Sardh C T 2: 27,244,477 R9H probably benign Het
Scgb3a2 C T 18: 43,766,754 P36S probably damaging Het
Scn10a C A 9: 119,694,309 G6V possibly damaging Het
Scn10a C T 9: 119,694,310 G6R possibly damaging Het
Scn3a T C 2: 65,461,032 D1790G probably damaging Het
Sec24b A T 3: 129,983,970 H1226Q probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc12a3 G A 8: 94,351,810 probably null Het
Slitrk6 T C 14: 110,751,883 T131A probably damaging Het
Spata1 C G 3: 146,469,774 D326H probably damaging Het
Tcrg-V4 T C 13: 19,185,066 V29A probably benign Het
Tex52 A T 6: 128,384,988 probably null Het
Tma16 A C 8: 66,481,477 C75W probably damaging Het
Tmem67 G A 4: 12,089,416 probably benign Het
Trmt10a A T 3: 138,148,385 K75* probably null Het
Ttc3 T C 16: 94,390,283 V228A probably benign Het
Ttn T C 2: 76,731,300 D28954G probably damaging Het
Uggt2 A G 14: 119,035,964 probably null Het
Vars T A 17: 35,015,726 V1177E probably benign Het
Vmn1r59 T C 7: 5,454,533 D76G possibly damaging Het
Vmn2r114 G T 17: 23,308,034 A508E probably benign Het
Vps41 G A 13: 18,829,255 V348M probably damaging Het
Zbtb43 T C 2: 33,453,932 H427R probably damaging Het
Other mutations in Nlrp12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00733:Nlrp12 APN 7 3240757 missense probably damaging 1.00
IGL01301:Nlrp12 APN 7 3240092 missense probably damaging 1.00
IGL01346:Nlrp12 APN 7 3240686 missense probably damaging 1.00
IGL01482:Nlrp12 APN 7 3235160 missense possibly damaging 0.65
IGL01534:Nlrp12 APN 7 3239833 missense probably benign 0.03
IGL02106:Nlrp12 APN 7 3233944 missense probably benign 0.02
IGL02159:Nlrp12 APN 7 3249545 utr 5 prime probably benign
IGL02184:Nlrp12 APN 7 3240464 missense probably damaging 0.99
IGL02221:Nlrp12 APN 7 3240967 missense possibly damaging 0.89
IGL02252:Nlrp12 APN 7 3245350 missense probably benign 0.01
ANU18:Nlrp12 UTSW 7 3240092 missense probably damaging 1.00
PIT4280001:Nlrp12 UTSW 7 3241433 missense possibly damaging 0.94
R0033:Nlrp12 UTSW 7 3240407 missense probably damaging 1.00
R0033:Nlrp12 UTSW 7 3240407 missense probably damaging 1.00
R0090:Nlrp12 UTSW 7 3240034 missense probably damaging 0.99
R0446:Nlrp12 UTSW 7 3234029 missense probably benign 0.00
R0503:Nlrp12 UTSW 7 3249377 missense probably damaging 0.97
R0538:Nlrp12 UTSW 7 3249262 missense possibly damaging 0.56
R1114:Nlrp12 UTSW 7 3228534 missense probably benign
R1680:Nlrp12 UTSW 7 3241174 missense probably damaging 1.00
R2030:Nlrp12 UTSW 7 3228417 missense probably damaging 1.00
R2096:Nlrp12 UTSW 7 3233195 missense probably benign 0.05
R2118:Nlrp12 UTSW 7 3241449 missense probably damaging 1.00
R2266:Nlrp12 UTSW 7 3233945 missense probably benign 0.00
R3615:Nlrp12 UTSW 7 3240575 missense probably benign 0.00
R3616:Nlrp12 UTSW 7 3240575 missense probably benign 0.00
R4375:Nlrp12 UTSW 7 3240946 missense possibly damaging 0.88
R4376:Nlrp12 UTSW 7 3240946 missense possibly damaging 0.88
R4379:Nlrp12 UTSW 7 3239924 missense probably benign 0.08
R4837:Nlrp12 UTSW 7 3231061 missense probably damaging 1.00
R4970:Nlrp12 UTSW 7 3240983 missense possibly damaging 0.72
R5112:Nlrp12 UTSW 7 3240983 missense possibly damaging 0.72
R5147:Nlrp12 UTSW 7 3241373 missense possibly damaging 0.79
R5505:Nlrp12 UTSW 7 3249385 missense probably damaging 0.99
R5636:Nlrp12 UTSW 7 3225294 missense probably damaging 0.99
R5891:Nlrp12 UTSW 7 3219259 utr 3 prime probably benign
R6039:Nlrp12 UTSW 7 3241372 missense possibly damaging 0.79
R6039:Nlrp12 UTSW 7 3241372 missense possibly damaging 0.79
R6365:Nlrp12 UTSW 7 3239888 missense probably benign 0.00
R6383:Nlrp12 UTSW 7 3234043 missense probably damaging 1.00
R6796:Nlrp12 UTSW 7 3241409 missense probably damaging 1.00
R6886:Nlrp12 UTSW 7 3240683 missense probably benign 0.03
R6957:Nlrp12 UTSW 7 3222486 missense probably damaging 1.00
R6995:Nlrp12 UTSW 7 3239851 missense probably benign
R7340:Nlrp12 UTSW 7 3233125 missense possibly damaging 0.93
R7346:Nlrp12 UTSW 7 3249257 missense probably damaging 0.96
R7387:Nlrp12 UTSW 7 3241201 missense probably damaging 0.97
R7414:Nlrp12 UTSW 7 3241347 missense probably benign 0.01
R7432:Nlrp12 UTSW 7 3222539 missense probably benign 0.14
R7729:Nlrp12 UTSW 7 3228388 critical splice donor site probably null
X0064:Nlrp12 UTSW 7 3241386 missense probably benign 0.14
X0065:Nlrp12 UTSW 7 3240575 missense probably benign 0.00
Z1088:Nlrp12 UTSW 7 3222537 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCGTTGAGGAGGCCAAACAG -3'
(R):5'- GTGGGGAGCTTTTAAGACAAAC -3'

Sequencing Primer
(F):5'- AGGGCCAAGAAGTTCCTTTC -3'
(R):5'- GGAGCTTTTAAGACAAACACCTAG -3'
Posted On2016-03-01