Incidental Mutation 'R4856:Dhx34'
ID373961
Institutional Source Beutler Lab
Gene Symbol Dhx34
Ensembl Gene ENSMUSG00000006019
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 34
Synonyms1200013B07Rik, Ddx34, 1810012L18Rik
MMRRC Submission 042467-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.497) question?
Stock #R4856 (G1)
Quality Score116
Status Not validated
Chromosome7
Chromosomal Location16197147-16222037 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16215442 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 354 (S354P)
Ref Sequence ENSEMBL: ENSMUSP00000126915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094816] [ENSMUST00000118795] [ENSMUST00000119102] [ENSMUST00000121123] [ENSMUST00000163968]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094816
AA Change: S354P

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092410
Gene: ENSMUSG00000006019
AA Change: S354P

DomainStartEndE-ValueType
low complexity region 4 26 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
DEXDc 150 343 7.73e-28 SMART
HELICc 400 498 4.31e-17 SMART
low complexity region 542 553 N/A INTRINSIC
HA2 558 648 3.35e-21 SMART
Pfam:OB_NTP_bind 687 911 2.6e-24 PFAM
low complexity region 953 971 N/A INTRINSIC
ZnF_C2H2 1121 1144 7.89e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000118795
AA Change: S354P

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112865
Gene: ENSMUSG00000006019
AA Change: S354P

DomainStartEndE-ValueType
low complexity region 4 26 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
DEXDc 150 343 7.73e-28 SMART
HELICc 400 498 4.31e-17 SMART
low complexity region 542 553 N/A INTRINSIC
HA2 558 648 3.35e-21 SMART
Pfam:OB_NTP_bind 687 911 7.5e-17 PFAM
low complexity region 953 971 N/A INTRINSIC
ZnF_C2H2 1121 1144 7.89e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000119102
AA Change: S354P

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113393
Gene: ENSMUSG00000006019
AA Change: S354P

DomainStartEndE-ValueType
low complexity region 4 26 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
DEXDc 150 343 7.73e-28 SMART
HELICc 400 498 4.31e-17 SMART
low complexity region 542 553 N/A INTRINSIC
HA2 558 648 3.35e-21 SMART
Pfam:OB_NTP_bind 687 911 7.5e-17 PFAM
low complexity region 953 971 N/A INTRINSIC
ZnF_C2H2 1121 1144 7.89e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121123
AA Change: S354P

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113673
Gene: ENSMUSG00000006019
AA Change: S354P

DomainStartEndE-ValueType
low complexity region 4 26 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
DEXDc 150 343 7.73e-28 SMART
HELICc 400 498 4.31e-17 SMART
low complexity region 542 553 N/A INTRINSIC
HA2 558 648 3.35e-21 SMART
Pfam:OB_NTP_bind 687 911 7.5e-17 PFAM
low complexity region 953 971 N/A INTRINSIC
ZnF_C2H2 1121 1144 7.89e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133518
Predicted Effect possibly damaging
Transcript: ENSMUST00000163968
AA Change: S354P

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126915
Gene: ENSMUSG00000006019
AA Change: S354P

DomainStartEndE-ValueType
low complexity region 4 26 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
DEXDc 150 343 7.73e-28 SMART
HELICc 400 498 4.31e-17 SMART
low complexity region 542 553 N/A INTRINSIC
HA2 558 648 3.35e-21 SMART
Pfam:OB_NTP_bind 687 911 6.4e-18 PFAM
low complexity region 953 971 N/A INTRINSIC
ZnF_C2H2 1121 1144 7.89e0 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. It is mapped to the glioma 19q tumor suppressor region and is a tumor suppressor candidate gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp2 G A 6: 140,644,073 probably null Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp2b4 T A 1: 133,706,780 I1177L probably benign Het
Bub3 A T 7: 131,561,568 D76V probably damaging Het
Cacna2d4 G A 6: 119,278,256 R578Q possibly damaging Het
Caprin2 A C 6: 148,873,011 S268A probably benign Het
Card6 T C 15: 5,105,141 probably null Het
Cdk13 A G 13: 17,719,734 S1103P probably benign Het
Cfap221 T C 1: 119,934,204 T614A probably damaging Het
Cfap221 T A 1: 119,984,758 Y133F probably damaging Het
Clcc1 A G 3: 108,676,838 T513A probably benign Het
Clec4g T A 8: 3,716,419 probably benign Het
Cntln A C 4: 84,971,229 E316D probably benign Het
Cpne2 T A 8: 94,563,964 D392E probably benign Het
Cry1 G T 10: 85,148,770 P147T probably damaging Het
Cyp4a29 T C 4: 115,252,881 V440A probably benign Het
Ddx46 A G 13: 55,638,199 D64G unknown Het
Ecm2 A T 13: 49,522,787 I327F possibly damaging Het
Elavl3 T C 9: 22,026,318 K189E possibly damaging Het
Enam A T 5: 88,488,734 R82* probably null Het
Erf A G 7: 25,246,211 V45A probably damaging Het
Fat3 T A 9: 16,021,330 I1436F probably benign Het
Flnc T C 6: 29,447,890 Y1231H probably damaging Het
Ggta1 T A 2: 35,402,791 H180L possibly damaging Het
Gm13103 G T 4: 143,853,303 R486L probably benign Het
Grin2c T C 11: 115,260,790 T115A probably damaging Het
H6pd C T 4: 149,982,778 V384M possibly damaging Het
Hba-x A G 11: 32,277,008 E39G probably benign Het
Hnrnpul2 C T 19: 8,829,827 P618S probably benign Het
Hpse2 C T 19: 42,788,957 R590H probably damaging Het
Ighv1-54 C A 12: 115,193,803 G75C probably damaging Het
Ighv8-11 C A 12: 115,567,154 R118L possibly damaging Het
Iqcm A T 8: 75,888,600 R436S possibly damaging Het
Islr T C 9: 58,157,606 D206G probably damaging Het
Itih1 A G 14: 30,936,701 probably null Het
Jam2 G A 16: 84,801,602 D34N probably benign Het
Klhl14 A T 18: 21,557,972 probably null Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Lrrc66 A G 5: 73,608,567 F378L probably benign Het
Map10 T A 8: 125,670,692 Y275N probably damaging Het
Mpi T C 9: 57,545,307 Y314C probably damaging Het
Mpp3 A G 11: 102,025,136 Y55H probably benign Het
Nectin4 T C 1: 171,384,815 V327A possibly damaging Het
Nlrp12 T A 7: 3,240,442 D480V probably damaging Het
Nolc1 GAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,083,155 probably benign Het
Notch2 A T 3: 98,102,419 Y554F probably damaging Het
Nrsn2 T C 2: 152,369,611 K167E probably benign Het
Olfr147 A T 9: 38,403,468 N195I probably damaging Het
Olfr1472 T C 19: 13,454,521 probably null Het
Olfr1501 T A 19: 13,838,279 E298V probably damaging Het
Olfr695 T A 7: 106,873,970 I92F probably damaging Het
Olfr761 A T 17: 37,952,071 S318T probably benign Het
Olr1 T A 6: 129,493,596 K203* probably null Het
Osbpl9 T C 4: 109,068,367 N485S probably benign Het
Pbk T A 14: 65,815,201 H164Q probably damaging Het
Pfn2 G T 3: 57,847,453 N10K probably damaging Het
Pik3ca A G 3: 32,437,163 D133G probably damaging Het
Prl6a1 A T 13: 27,319,000 D193V probably damaging Het
Rad21 G T 15: 51,968,500 P395Q probably damaging Het
Reps1 T A 10: 18,123,625 I720N probably damaging Het
Rpn2 T C 2: 157,318,044 probably null Het
Rreb1 G A 13: 37,931,058 V798M possibly damaging Het
Sardh C T 2: 27,244,477 R9H probably benign Het
Scgb3a2 C T 18: 43,766,754 P36S probably damaging Het
Scn10a C A 9: 119,694,309 G6V possibly damaging Het
Scn10a C T 9: 119,694,310 G6R possibly damaging Het
Scn3a T C 2: 65,461,032 D1790G probably damaging Het
Sec24b A T 3: 129,983,970 H1226Q probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc12a3 G A 8: 94,351,810 probably null Het
Slitrk6 T C 14: 110,751,883 T131A probably damaging Het
Spata1 C G 3: 146,469,774 D326H probably damaging Het
Tcrg-V4 T C 13: 19,185,066 V29A probably benign Het
Tex52 A T 6: 128,384,988 probably null Het
Tma16 A C 8: 66,481,477 C75W probably damaging Het
Tmem67 G A 4: 12,089,416 probably benign Het
Trmt10a A T 3: 138,148,385 K75* probably null Het
Ttc3 T C 16: 94,390,283 V228A probably benign Het
Ttn T C 2: 76,731,300 D28954G probably damaging Het
Uggt2 A G 14: 119,035,964 probably null Het
Vars T A 17: 35,015,726 V1177E probably benign Het
Vmn1r59 T C 7: 5,454,533 D76G possibly damaging Het
Vmn2r114 G T 17: 23,308,034 A508E probably benign Het
Vps41 G A 13: 18,829,255 V348M probably damaging Het
Zbtb43 T C 2: 33,453,932 H427R probably damaging Het
Other mutations in Dhx34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Dhx34 APN 7 16199826 missense probably damaging 1.00
IGL01090:Dhx34 APN 7 16216256 missense probably damaging 1.00
IGL01397:Dhx34 APN 7 16210543 missense probably damaging 1.00
IGL01637:Dhx34 APN 7 16205473 missense probably damaging 1.00
IGL01684:Dhx34 APN 7 16203279 missense probably damaging 1.00
IGL02147:Dhx34 APN 7 16204003 missense probably benign 0.01
IGL02223:Dhx34 APN 7 16198659 missense probably benign 0.10
R0255:Dhx34 UTSW 7 16205992 missense probably benign 0.32
R0514:Dhx34 UTSW 7 16210537 missense probably benign 0.02
R0919:Dhx34 UTSW 7 16201958 missense probably damaging 0.99
R1075:Dhx34 UTSW 7 16218349 missense probably benign 0.06
R1077:Dhx34 UTSW 7 16218368 missense probably damaging 0.97
R4197:Dhx34 UTSW 7 16203726 missense probably damaging 1.00
R4721:Dhx34 UTSW 7 16197382 missense possibly damaging 0.83
R4868:Dhx34 UTSW 7 16199802 missense probably benign 0.10
R5134:Dhx34 UTSW 7 16218250 missense possibly damaging 0.57
R5180:Dhx34 UTSW 7 16205480 nonsense probably null
R5560:Dhx34 UTSW 7 16218541 missense probably benign 0.34
R5588:Dhx34 UTSW 7 16198900 missense probably damaging 0.99
R6981:Dhx34 UTSW 7 16215330 missense possibly damaging 0.87
R6994:Dhx34 UTSW 7 16203874 missense probably benign 0.04
R7226:Dhx34 UTSW 7 16198876 missense probably damaging 1.00
R7262:Dhx34 UTSW 7 16203698 missense probably benign 0.01
R7288:Dhx34 UTSW 7 16215436 missense probably benign 0.08
R7381:Dhx34 UTSW 7 16215448 missense probably benign 0.00
R7469:Dhx34 UTSW 7 16216439 missense probably benign 0.00
R7709:Dhx34 UTSW 7 16212864 missense possibly damaging 0.55
R7862:Dhx34 UTSW 7 16210523 missense probably damaging 0.98
R8495:Dhx34 UTSW 7 16218547 missense probably benign 0.01
X0020:Dhx34 UTSW 7 16205992 missense probably benign 0.32
Z1176:Dhx34 UTSW 7 16218644 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCTGGTCAGACACAGAGAG -3'
(R):5'- TCTAGCACTGTCAGCACCTCAG -3'

Sequencing Primer
(F):5'- TCAGACACAGAGAGGGCGC -3'
(R):5'- TTACCCACCTTGAGTGTG -3'
Posted On2016-03-01