Incidental Mutation 'R4856:Bub3'
ID373964
Institutional Source Beutler Lab
Gene Symbol Bub3
Ensembl Gene ENSMUSG00000066979
Gene NameBUB3 mitotic checkpoint protein
Synonyms
MMRRC Submission 042467-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4856 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location131560222-131571895 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 131561568 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 76 (D76V)
Ref Sequence ENSEMBL: ENSMUSP00000147045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051997] [ENSMUST00000084502] [ENSMUST00000124096] [ENSMUST00000183219] [ENSMUST00000207231] [ENSMUST00000207442] [ENSMUST00000207736] [ENSMUST00000208571]
Predicted Effect probably benign
Transcript: ENSMUST00000051997
SMART Domains Protein: ENSMUSP00000058205
Gene: ENSMUSG00000050100

DomainStartEndE-ValueType
low complexity region 46 58 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
HOX 149 211 1.31e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000084502
AA Change: D76V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000081547
Gene: ENSMUSG00000066979
AA Change: D76V

DomainStartEndE-ValueType
WD40 2 43 5.69e-4 SMART
WD40 46 83 8.91e-1 SMART
WD40 88 124 5.1e-6 SMART
WD40 127 163 6.16e0 SMART
WD40 214 262 4.02e-4 SMART
WD40 265 302 1.97e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183219
SMART Domains Protein: ENSMUSP00000138799
Gene: ENSMUSG00000050100

DomainStartEndE-ValueType
low complexity region 46 58 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
HOX 149 211 1.31e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000207231
AA Change: D76V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000207442
AA Change: D76V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000207736
AA Change: D76V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000208571
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209131
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a component of the mitotic spindle assembly complex. The encoded protein is involved in the regulation of chromosome segregation during oocyte meiosis. Disruption of this gene results in the accumulation of mitotic errors and is lethal in the embryonic stage. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality by E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp2 G A 6: 140,644,073 probably null Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp2b4 T A 1: 133,706,780 I1177L probably benign Het
Cacna2d4 G A 6: 119,278,256 R578Q possibly damaging Het
Caprin2 A C 6: 148,873,011 S268A probably benign Het
Card6 T C 15: 5,105,141 probably null Het
Cdk13 A G 13: 17,719,734 S1103P probably benign Het
Cfap221 T C 1: 119,934,204 T614A probably damaging Het
Cfap221 T A 1: 119,984,758 Y133F probably damaging Het
Clcc1 A G 3: 108,676,838 T513A probably benign Het
Clec4g T A 8: 3,716,419 probably benign Het
Cntln A C 4: 84,971,229 E316D probably benign Het
Cpne2 T A 8: 94,563,964 D392E probably benign Het
Cry1 G T 10: 85,148,770 P147T probably damaging Het
Cyp4a29 T C 4: 115,252,881 V440A probably benign Het
Ddx46 A G 13: 55,638,199 D64G unknown Het
Dhx34 A G 7: 16,215,442 S354P possibly damaging Het
Ecm2 A T 13: 49,522,787 I327F possibly damaging Het
Elavl3 T C 9: 22,026,318 K189E possibly damaging Het
Enam A T 5: 88,488,734 R82* probably null Het
Erf A G 7: 25,246,211 V45A probably damaging Het
Fat3 T A 9: 16,021,330 I1436F probably benign Het
Flnc T C 6: 29,447,890 Y1231H probably damaging Het
Ggta1 T A 2: 35,402,791 H180L possibly damaging Het
Gm13103 G T 4: 143,853,303 R486L probably benign Het
Grin2c T C 11: 115,260,790 T115A probably damaging Het
H6pd C T 4: 149,982,778 V384M possibly damaging Het
Hba-x A G 11: 32,277,008 E39G probably benign Het
Hnrnpul2 C T 19: 8,829,827 P618S probably benign Het
Hpse2 C T 19: 42,788,957 R590H probably damaging Het
Ighv1-54 C A 12: 115,193,803 G75C probably damaging Het
Ighv8-11 C A 12: 115,567,154 R118L possibly damaging Het
Iqcm A T 8: 75,888,600 R436S possibly damaging Het
Islr T C 9: 58,157,606 D206G probably damaging Het
Itih1 A G 14: 30,936,701 probably null Het
Jam2 G A 16: 84,801,602 D34N probably benign Het
Klhl14 A T 18: 21,557,972 probably null Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Lrrc66 A G 5: 73,608,567 F378L probably benign Het
Map10 T A 8: 125,670,692 Y275N probably damaging Het
Mpi T C 9: 57,545,307 Y314C probably damaging Het
Mpp3 A G 11: 102,025,136 Y55H probably benign Het
Nectin4 T C 1: 171,384,815 V327A possibly damaging Het
Nlrp12 T A 7: 3,240,442 D480V probably damaging Het
Nolc1 GAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,083,155 probably benign Het
Notch2 A T 3: 98,102,419 Y554F probably damaging Het
Nrsn2 T C 2: 152,369,611 K167E probably benign Het
Olfr147 A T 9: 38,403,468 N195I probably damaging Het
Olfr1472 T C 19: 13,454,521 probably null Het
Olfr1501 T A 19: 13,838,279 E298V probably damaging Het
Olfr695 T A 7: 106,873,970 I92F probably damaging Het
Olfr761 A T 17: 37,952,071 S318T probably benign Het
Olr1 T A 6: 129,493,596 K203* probably null Het
Osbpl9 T C 4: 109,068,367 N485S probably benign Het
Pbk T A 14: 65,815,201 H164Q probably damaging Het
Pfn2 G T 3: 57,847,453 N10K probably damaging Het
Pik3ca A G 3: 32,437,163 D133G probably damaging Het
Prl6a1 A T 13: 27,319,000 D193V probably damaging Het
Rad21 G T 15: 51,968,500 P395Q probably damaging Het
Reps1 T A 10: 18,123,625 I720N probably damaging Het
Rpn2 T C 2: 157,318,044 probably null Het
Rreb1 G A 13: 37,931,058 V798M possibly damaging Het
Sardh C T 2: 27,244,477 R9H probably benign Het
Scgb3a2 C T 18: 43,766,754 P36S probably damaging Het
Scn10a C A 9: 119,694,309 G6V possibly damaging Het
Scn10a C T 9: 119,694,310 G6R possibly damaging Het
Scn3a T C 2: 65,461,032 D1790G probably damaging Het
Sec24b A T 3: 129,983,970 H1226Q probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc12a3 G A 8: 94,351,810 probably null Het
Slitrk6 T C 14: 110,751,883 T131A probably damaging Het
Spata1 C G 3: 146,469,774 D326H probably damaging Het
Tcrg-V4 T C 13: 19,185,066 V29A probably benign Het
Tex52 A T 6: 128,384,988 probably null Het
Tma16 A C 8: 66,481,477 C75W probably damaging Het
Tmem67 G A 4: 12,089,416 probably benign Het
Trmt10a A T 3: 138,148,385 K75* probably null Het
Ttc3 T C 16: 94,390,283 V228A probably benign Het
Ttn T C 2: 76,731,300 D28954G probably damaging Het
Uggt2 A G 14: 119,035,964 probably null Het
Vars T A 17: 35,015,726 V1177E probably benign Het
Vmn1r59 T C 7: 5,454,533 D76G possibly damaging Het
Vmn2r114 G T 17: 23,308,034 A508E probably benign Het
Vps41 G A 13: 18,829,255 V348M probably damaging Het
Zbtb43 T C 2: 33,453,932 H427R probably damaging Het
Other mutations in Bub3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01813:Bub3 APN 7 131568633 missense probably benign 0.34
R0294:Bub3 UTSW 7 131568224 missense possibly damaging 0.83
R1591:Bub3 UTSW 7 131561608 critical splice donor site probably null
R2679:Bub3 UTSW 7 131568725 splice site probably null
R2847:Bub3 UTSW 7 131570884 missense possibly damaging 0.79
R4392:Bub3 UTSW 7 131566335 missense probably benign 0.01
R4992:Bub3 UTSW 7 131560806 missense probably damaging 1.00
R5364:Bub3 UTSW 7 131560738 missense possibly damaging 0.93
R7536:Bub3 UTSW 7 131568703 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGCTCCAAATGTAAGAGTGG -3'
(R):5'- CTGCAAAATTCAGGTTCCATTTGTG -3'

Sequencing Primer
(F):5'- CTCCAAATGTAAGAGTGGGGTGG -3'
(R):5'- GGTTCCATTTGTGGTAACTTAATCC -3'
Posted On2016-03-01