Incidental Mutation 'R4856:Olfr147'
ID373972
Institutional Source Beutler Lab
Gene Symbol Olfr147
Ensembl Gene ENSMUSG00000049098
Gene Nameolfactory receptor 147
SynonymsM3, GA_x6K02T2PVTD-32098059-32099003, MOR164-1
MMRRC Submission 042467-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R4856 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location38401698-38407997 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38403468 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 195 (N195I)
Ref Sequence ENSEMBL: ENSMUSP00000149480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056364] [ENSMUST00000214648]
Predicted Effect probably damaging
Transcript: ENSMUST00000056364
AA Change: N198I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000051933
Gene: ENSMUSG00000049098
AA Change: N198I

DomainStartEndE-ValueType
Pfam:7tm_4 34 310 1.2e-48 PFAM
Pfam:7tm_1 44 292 2.8e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214648
AA Change: N195I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp2 G A 6: 140,644,073 probably null Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp2b4 T A 1: 133,706,780 I1177L probably benign Het
Bub3 A T 7: 131,561,568 D76V probably damaging Het
Cacna2d4 G A 6: 119,278,256 R578Q possibly damaging Het
Caprin2 A C 6: 148,873,011 S268A probably benign Het
Card6 T C 15: 5,105,141 probably null Het
Cdk13 A G 13: 17,719,734 S1103P probably benign Het
Cfap221 T C 1: 119,934,204 T614A probably damaging Het
Cfap221 T A 1: 119,984,758 Y133F probably damaging Het
Clcc1 A G 3: 108,676,838 T513A probably benign Het
Clec4g T A 8: 3,716,419 probably benign Het
Cntln A C 4: 84,971,229 E316D probably benign Het
Cpne2 T A 8: 94,563,964 D392E probably benign Het
Cry1 G T 10: 85,148,770 P147T probably damaging Het
Cyp4a29 T C 4: 115,252,881 V440A probably benign Het
Ddx46 A G 13: 55,638,199 D64G unknown Het
Dhx34 A G 7: 16,215,442 S354P possibly damaging Het
Ecm2 A T 13: 49,522,787 I327F possibly damaging Het
Elavl3 T C 9: 22,026,318 K189E possibly damaging Het
Enam A T 5: 88,488,734 R82* probably null Het
Erf A G 7: 25,246,211 V45A probably damaging Het
Fat3 T A 9: 16,021,330 I1436F probably benign Het
Flnc T C 6: 29,447,890 Y1231H probably damaging Het
Ggta1 T A 2: 35,402,791 H180L possibly damaging Het
Gm13103 G T 4: 143,853,303 R486L probably benign Het
Grin2c T C 11: 115,260,790 T115A probably damaging Het
H6pd C T 4: 149,982,778 V384M possibly damaging Het
Hba-x A G 11: 32,277,008 E39G probably benign Het
Hnrnpul2 C T 19: 8,829,827 P618S probably benign Het
Hpse2 C T 19: 42,788,957 R590H probably damaging Het
Ighv1-54 C A 12: 115,193,803 G75C probably damaging Het
Ighv8-11 C A 12: 115,567,154 R118L possibly damaging Het
Iqcm A T 8: 75,888,600 R436S possibly damaging Het
Islr T C 9: 58,157,606 D206G probably damaging Het
Itih1 A G 14: 30,936,701 probably null Het
Jam2 G A 16: 84,801,602 D34N probably benign Het
Klhl14 A T 18: 21,557,972 probably null Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Lrrc66 A G 5: 73,608,567 F378L probably benign Het
Map10 T A 8: 125,670,692 Y275N probably damaging Het
Mpi T C 9: 57,545,307 Y314C probably damaging Het
Mpp3 A G 11: 102,025,136 Y55H probably benign Het
Nectin4 T C 1: 171,384,815 V327A possibly damaging Het
Nlrp12 T A 7: 3,240,442 D480V probably damaging Het
Nolc1 GAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,083,155 probably benign Het
Notch2 A T 3: 98,102,419 Y554F probably damaging Het
Nrsn2 T C 2: 152,369,611 K167E probably benign Het
Olfr1472 T C 19: 13,454,521 probably null Het
Olfr1501 T A 19: 13,838,279 E298V probably damaging Het
Olfr695 T A 7: 106,873,970 I92F probably damaging Het
Olfr761 A T 17: 37,952,071 S318T probably benign Het
Olr1 T A 6: 129,493,596 K203* probably null Het
Osbpl9 T C 4: 109,068,367 N485S probably benign Het
Pbk T A 14: 65,815,201 H164Q probably damaging Het
Pfn2 G T 3: 57,847,453 N10K probably damaging Het
Pik3ca A G 3: 32,437,163 D133G probably damaging Het
Prl6a1 A T 13: 27,319,000 D193V probably damaging Het
Rad21 G T 15: 51,968,500 P395Q probably damaging Het
Reps1 T A 10: 18,123,625 I720N probably damaging Het
Rpn2 T C 2: 157,318,044 probably null Het
Rreb1 G A 13: 37,931,058 V798M possibly damaging Het
Sardh C T 2: 27,244,477 R9H probably benign Het
Scgb3a2 C T 18: 43,766,754 P36S probably damaging Het
Scn10a C A 9: 119,694,309 G6V possibly damaging Het
Scn10a C T 9: 119,694,310 G6R possibly damaging Het
Scn3a T C 2: 65,461,032 D1790G probably damaging Het
Sec24b A T 3: 129,983,970 H1226Q probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc12a3 G A 8: 94,351,810 probably null Het
Slitrk6 T C 14: 110,751,883 T131A probably damaging Het
Spata1 C G 3: 146,469,774 D326H probably damaging Het
Tcrg-V4 T C 13: 19,185,066 V29A probably benign Het
Tex52 A T 6: 128,384,988 probably null Het
Tma16 A C 8: 66,481,477 C75W probably damaging Het
Tmem67 G A 4: 12,089,416 probably benign Het
Trmt10a A T 3: 138,148,385 K75* probably null Het
Ttc3 T C 16: 94,390,283 V228A probably benign Het
Ttn T C 2: 76,731,300 D28954G probably damaging Het
Uggt2 A G 14: 119,035,964 probably null Het
Vars T A 17: 35,015,726 V1177E probably benign Het
Vmn1r59 T C 7: 5,454,533 D76G possibly damaging Het
Vmn2r114 G T 17: 23,308,034 A508E probably benign Het
Vps41 G A 13: 18,829,255 V348M probably damaging Het
Zbtb43 T C 2: 33,453,932 H427R probably damaging Het
Other mutations in Olfr147
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01685:Olfr147 APN 9 38403021 missense possibly damaging 0.67
IGL02109:Olfr147 APN 9 38403086 missense possibly damaging 0.91
IGL02805:Olfr147 APN 9 38403836 utr 3 prime probably benign
IGL02875:Olfr147 APN 9 38403176 missense probably damaging 0.99
R1133:Olfr147 UTSW 9 38403731 missense probably benign 0.00
R1446:Olfr147 UTSW 9 38403305 missense possibly damaging 0.73
R1591:Olfr147 UTSW 9 38402936 missense probably damaging 1.00
R1719:Olfr147 UTSW 9 38403254 missense possibly damaging 0.67
R1895:Olfr147 UTSW 9 38402886 start codon destroyed probably null 0.88
R1946:Olfr147 UTSW 9 38402886 start codon destroyed probably null 0.88
R1981:Olfr147 UTSW 9 38403735 missense probably damaging 0.99
R2033:Olfr147 UTSW 9 38403373 missense probably damaging 0.99
R5322:Olfr147 UTSW 9 38403566 missense probably damaging 1.00
R6017:Olfr147 UTSW 9 38403620 missense probably benign 0.01
R6037:Olfr147 UTSW 9 38403305 missense probably benign 0.07
R6037:Olfr147 UTSW 9 38403305 missense probably benign 0.07
R7032:Olfr147 UTSW 9 38403669 missense possibly damaging 0.53
R7042:Olfr147 UTSW 9 38402900 missense probably damaging 0.98
R7351:Olfr147 UTSW 9 38403443 missense probably damaging 1.00
R7460:Olfr147 UTSW 9 38403353 missense possibly damaging 0.95
R7820:Olfr147 UTSW 9 38403566 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGGTCACCATGTCCCCTC -3'
(R):5'- TTTCCTTGTTCCATAGATCCAGAAG -3'

Sequencing Primer
(F):5'- GGTCACCATGTCCCCTCAGATC -3'
(R):5'- GATACATAAATGCAGCTGATCCAAAG -3'
Posted On2016-03-01