Incidental Mutation 'R4856:Cdk13'
ID373988
Institutional Source Beutler Lab
Gene Symbol Cdk13
Ensembl Gene ENSMUSG00000041297
Gene Namecyclin-dependent kinase 13
Synonyms2310015O17Rik, Cdc2l5
MMRRC Submission 042467-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4856 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location17710315-17805097 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17719734 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1103 (S1103P)
Ref Sequence ENSEMBL: ENSMUSP00000036013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042365] [ENSMUST00000222800] [ENSMUST00000223490]
Predicted Effect probably benign
Transcript: ENSMUST00000042365
AA Change: S1103P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000036013
Gene: ENSMUSG00000041297
AA Change: S1103P

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 32 86 N/A INTRINSIC
low complexity region 93 113 N/A INTRINSIC
low complexity region 130 139 N/A INTRINSIC
low complexity region 160 187 N/A INTRINSIC
low complexity region 189 225 N/A INTRINSIC
low complexity region 238 272 N/A INTRINSIC
low complexity region 337 377 N/A INTRINSIC
low complexity region 384 402 N/A INTRINSIC
low complexity region 405 442 N/A INTRINSIC
low complexity region 450 490 N/A INTRINSIC
internal_repeat_1 553 599 6.15e-5 PROSPERO
low complexity region 607 617 N/A INTRINSIC
low complexity region 631 641 N/A INTRINSIC
low complexity region 645 661 N/A INTRINSIC
S_TKc 705 998 7.25e-94 SMART
low complexity region 1173 1184 N/A INTRINSIC
internal_repeat_1 1190 1236 6.15e-5 PROSPERO
low complexity region 1248 1273 N/A INTRINSIC
low complexity region 1299 1311 N/A INTRINSIC
low complexity region 1355 1360 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222359
Predicted Effect probably benign
Transcript: ENSMUST00000222800
Predicted Effect probably benign
Transcript: ENSMUST00000223490
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the cyclin-dependent serine/threonine protein kinase family. Members of this family are well known for their essential roles as master switches in cell cycle control. The exact function of this protein has not yet been determined, but it may play a role in mRNA processing and may be involved in regulation of hematopoiesis. Alternatively spliced transcript variants have been described.[provided by RefSeq, Dec 2009]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp2 G A 6: 140,644,073 probably null Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp2b4 T A 1: 133,706,780 I1177L probably benign Het
Bub3 A T 7: 131,561,568 D76V probably damaging Het
Cacna2d4 G A 6: 119,278,256 R578Q possibly damaging Het
Caprin2 A C 6: 148,873,011 S268A probably benign Het
Card6 T C 15: 5,105,141 probably null Het
Cfap221 T C 1: 119,934,204 T614A probably damaging Het
Cfap221 T A 1: 119,984,758 Y133F probably damaging Het
Clcc1 A G 3: 108,676,838 T513A probably benign Het
Clec4g T A 8: 3,716,419 probably benign Het
Cntln A C 4: 84,971,229 E316D probably benign Het
Cpne2 T A 8: 94,563,964 D392E probably benign Het
Cry1 G T 10: 85,148,770 P147T probably damaging Het
Cyp4a29 T C 4: 115,252,881 V440A probably benign Het
Ddx46 A G 13: 55,638,199 D64G unknown Het
Dhx34 A G 7: 16,215,442 S354P possibly damaging Het
Ecm2 A T 13: 49,522,787 I327F possibly damaging Het
Elavl3 T C 9: 22,026,318 K189E possibly damaging Het
Enam A T 5: 88,488,734 R82* probably null Het
Erf A G 7: 25,246,211 V45A probably damaging Het
Fat3 T A 9: 16,021,330 I1436F probably benign Het
Flnc T C 6: 29,447,890 Y1231H probably damaging Het
Ggta1 T A 2: 35,402,791 H180L possibly damaging Het
Gm13103 G T 4: 143,853,303 R486L probably benign Het
Grin2c T C 11: 115,260,790 T115A probably damaging Het
H6pd C T 4: 149,982,778 V384M possibly damaging Het
Hba-x A G 11: 32,277,008 E39G probably benign Het
Hnrnpul2 C T 19: 8,829,827 P618S probably benign Het
Hpse2 C T 19: 42,788,957 R590H probably damaging Het
Ighv1-54 C A 12: 115,193,803 G75C probably damaging Het
Ighv8-11 C A 12: 115,567,154 R118L possibly damaging Het
Iqcm A T 8: 75,888,600 R436S possibly damaging Het
Islr T C 9: 58,157,606 D206G probably damaging Het
Itih1 A G 14: 30,936,701 probably null Het
Jam2 G A 16: 84,801,602 D34N probably benign Het
Klhl14 A T 18: 21,557,972 probably null Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Lrrc66 A G 5: 73,608,567 F378L probably benign Het
Map10 T A 8: 125,670,692 Y275N probably damaging Het
Mpi T C 9: 57,545,307 Y314C probably damaging Het
Mpp3 A G 11: 102,025,136 Y55H probably benign Het
Nectin4 T C 1: 171,384,815 V327A possibly damaging Het
Nlrp12 T A 7: 3,240,442 D480V probably damaging Het
Nolc1 GAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,083,155 probably benign Het
Notch2 A T 3: 98,102,419 Y554F probably damaging Het
Nrsn2 T C 2: 152,369,611 K167E probably benign Het
Olfr147 A T 9: 38,403,468 N195I probably damaging Het
Olfr1472 T C 19: 13,454,521 probably null Het
Olfr1501 T A 19: 13,838,279 E298V probably damaging Het
Olfr695 T A 7: 106,873,970 I92F probably damaging Het
Olfr761 A T 17: 37,952,071 S318T probably benign Het
Olr1 T A 6: 129,493,596 K203* probably null Het
Osbpl9 T C 4: 109,068,367 N485S probably benign Het
Pbk T A 14: 65,815,201 H164Q probably damaging Het
Pfn2 G T 3: 57,847,453 N10K probably damaging Het
Pik3ca A G 3: 32,437,163 D133G probably damaging Het
Prl6a1 A T 13: 27,319,000 D193V probably damaging Het
Rad21 G T 15: 51,968,500 P395Q probably damaging Het
Reps1 T A 10: 18,123,625 I720N probably damaging Het
Rpn2 T C 2: 157,318,044 probably null Het
Rreb1 G A 13: 37,931,058 V798M possibly damaging Het
Sardh C T 2: 27,244,477 R9H probably benign Het
Scgb3a2 C T 18: 43,766,754 P36S probably damaging Het
Scn10a C A 9: 119,694,309 G6V possibly damaging Het
Scn10a C T 9: 119,694,310 G6R possibly damaging Het
Scn3a T C 2: 65,461,032 D1790G probably damaging Het
Sec24b A T 3: 129,983,970 H1226Q probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc12a3 G A 8: 94,351,810 probably null Het
Slitrk6 T C 14: 110,751,883 T131A probably damaging Het
Spata1 C G 3: 146,469,774 D326H probably damaging Het
Tcrg-V4 T C 13: 19,185,066 V29A probably benign Het
Tex52 A T 6: 128,384,988 probably null Het
Tma16 A C 8: 66,481,477 C75W probably damaging Het
Tmem67 G A 4: 12,089,416 probably benign Het
Trmt10a A T 3: 138,148,385 K75* probably null Het
Ttc3 T C 16: 94,390,283 V228A probably benign Het
Ttn T C 2: 76,731,300 D28954G probably damaging Het
Uggt2 A G 14: 119,035,964 probably null Het
Vars T A 17: 35,015,726 V1177E probably benign Het
Vmn1r59 T C 7: 5,454,533 D76G possibly damaging Het
Vmn2r114 G T 17: 23,308,034 A508E probably benign Het
Vps41 G A 13: 18,829,255 V348M probably damaging Het
Zbtb43 T C 2: 33,453,932 H427R probably damaging Het
Other mutations in Cdk13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Cdk13 APN 13 17721098 missense possibly damaging 0.88
IGL00800:Cdk13 APN 13 17728142 missense probably damaging 1.00
IGL02186:Cdk13 APN 13 17772527 missense probably benign 0.02
IGL02447:Cdk13 APN 13 17772416 missense probably benign 0.10
IGL02494:Cdk13 APN 13 17739125 nonsense probably null
IGL02542:Cdk13 APN 13 17728178 missense probably damaging 0.99
IGL02602:Cdk13 APN 13 17727160 missense probably damaging 0.99
Vortex UTSW 13 17739154 missense probably damaging 1.00
Whirlpool UTSW 13 17772403 missense possibly damaging 0.92
R0115:Cdk13 UTSW 13 17719494 missense probably damaging 0.99
R0421:Cdk13 UTSW 13 17763170 missense probably damaging 0.99
R0481:Cdk13 UTSW 13 17719494 missense probably damaging 0.99
R0681:Cdk13 UTSW 13 17721297 splice site probably benign
R1432:Cdk13 UTSW 13 17718416 missense probably damaging 1.00
R2013:Cdk13 UTSW 13 17739163 nonsense probably null
R2221:Cdk13 UTSW 13 17719535 missense probably damaging 0.99
R2332:Cdk13 UTSW 13 17718695 missense probably damaging 1.00
R2389:Cdk13 UTSW 13 17751776 missense probably damaging 1.00
R4546:Cdk13 UTSW 13 17766574 missense probably damaging 0.98
R4753:Cdk13 UTSW 13 17763248 missense probably damaging 1.00
R4855:Cdk13 UTSW 13 17721283 missense probably damaging 1.00
R4861:Cdk13 UTSW 13 17766586 missense probably damaging 1.00
R4861:Cdk13 UTSW 13 17766586 missense probably damaging 1.00
R4886:Cdk13 UTSW 13 17719734 missense probably benign
R4909:Cdk13 UTSW 13 17772403 missense possibly damaging 0.92
R5152:Cdk13 UTSW 13 17718525 missense probably benign 0.13
R5308:Cdk13 UTSW 13 17772313 missense probably damaging 0.98
R5350:Cdk13 UTSW 13 17803930 unclassified probably benign
R5412:Cdk13 UTSW 13 17766530 missense probably damaging 1.00
R5493:Cdk13 UTSW 13 17803562 unclassified probably benign
R5719:Cdk13 UTSW 13 17719655 missense probably damaging 0.98
R6052:Cdk13 UTSW 13 17721215 missense probably damaging 1.00
R6349:Cdk13 UTSW 13 17751719 missense probably damaging 1.00
R6415:Cdk13 UTSW 13 17739154 missense probably damaging 1.00
R7665:Cdk13 UTSW 13 17772553 missense possibly damaging 0.78
R7666:Cdk13 UTSW 13 17772576 start gained probably benign
R7764:Cdk13 UTSW 13 17721305 splice site probably null
R8100:Cdk13 UTSW 13 17803516 missense unknown
RF009:Cdk13 UTSW 13 17803744 missense unknown
Predicted Primers PCR Primer
(F):5'- TCTGTGAAGGCTGAACTCCTC -3'
(R):5'- TCATGACAGTGAGTAGACTGAAGTG -3'

Sequencing Primer
(F):5'- CCCAATGATTTTGAAGACTCCTG -3'
(R):5'- CAGTGAGTAGACTGAAGTGCTCATTC -3'
Posted On2016-03-01