Incidental Mutation 'R4857:Ptprf'
ID374034
Institutional Source Beutler Lab
Gene Symbol Ptprf
Ensembl Gene ENSMUSG00000033295
Gene Nameprotein tyrosine phosphatase, receptor type, F
SynonymsRPTP-LAR, LAR
MMRRC Submission 042468-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.785) question?
Stock #R4857 (G1)
Quality Score157
Status Validated
Chromosome4
Chromosomal Location118208213-118291405 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 118217197 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000049074]
Predicted Effect probably benign
Transcript: ENSMUST00000049074
SMART Domains Protein: ENSMUSP00000039368
Gene: ENSMUSG00000033295

DomainStartEndE-ValueType
IGc2 45 114 2.64e-12 SMART
IGc2 147 214 1.48e-15 SMART
IG 238 316 1.06e-11 SMART
FN3 319 398 6.9e-14 SMART
FN3 414 497 5.73e-11 SMART
FN3 512 591 4.06e-11 SMART
FN3 606 693 8.69e-11 SMART
FN3 709 797 8.83e-12 SMART
FN3 812 892 3.2e-9 SMART
FN3 907 988 2.53e-12 SMART
FN3 1003 1079 3.48e-1 SMART
coiled coil region 1146 1175 N/A INTRINSIC
transmembrane domain 1253 1275 N/A INTRINSIC
PTPc 1342 1600 1.12e-138 SMART
PTPc 1629 1891 3.4e-129 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123484
Predicted Effect probably benign
Transcript: ENSMUST00000124758
SMART Domains Protein: ENSMUSP00000119954
Gene: ENSMUSG00000033295

DomainStartEndE-ValueType
FN3 37 116 4.06e-11 SMART
FN3 132 220 8.83e-12 SMART
FN3 235 315 3.2e-9 SMART
FN3 330 411 2.53e-12 SMART
FN3 426 502 3.48e-1 SMART
coiled coil region 568 597 N/A INTRINSIC
transmembrane domain 676 698 N/A INTRINSIC
PTPc 776 1034 1.12e-138 SMART
PTPc 1063 1325 3.4e-129 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150096
SMART Domains Protein: ENSMUSP00000117313
Gene: ENSMUSG00000033295

DomainStartEndE-ValueType
FN3 14 66 2.7e1 SMART
FN3 82 165 5.73e-11 SMART
FN3 180 259 4.06e-11 SMART
FN3 275 372 6.69e-12 SMART
FN3 385 461 2.83e-1 SMART
coiled coil region 527 556 N/A INTRINSIC
transmembrane domain 635 657 N/A INTRINSIC
PTPc 735 993 1.12e-138 SMART
PTPc 1022 1284 3.4e-129 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.3%
Validation Efficiency 97% (115/119)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains three Ig-like domains, and nine non-Ig like domains similar to that of neural-cell adhesion molecule. This PTP was shown to function in the regulation of epithelial cell-cell contacts at adherents junctions, as well as in the control of beta-catenin signaling. An increased expression level of this protein was found in the insulin-responsive tissue of obese, insulin-resistant individuals, and may contribute to the pathogenesis of insulin resistance. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null females have premature involution of the mammary glands leading to an inability to feed pups. Other characteristics of null mice include defective nerve regeneration and hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548G14Rik C T 15: 46,625,531 noncoding transcript Het
4932415D10Rik T C 10: 82,283,848 T4443A possibly damaging Het
Aasdh A T 5: 76,887,284 F428L probably benign Het
Abca13 A G 11: 9,294,143 N2002S probably benign Het
Acot7 T G 4: 152,237,754 F248V possibly damaging Het
Acsf2 A G 11: 94,569,338 I396T probably benign Het
Agbl1 A G 7: 76,419,835 N372D probably benign Het
Ahctf1 A T 1: 179,799,357 probably benign Het
Akap11 T C 14: 78,498,860 D1830G Het
Bcl7b A G 5: 135,173,179 *59W probably null Het
Bdh1 A G 16: 31,447,548 probably null Het
Bin3 A G 14: 70,128,895 N69S probably benign Het
Bsdc1 T C 4: 129,471,892 probably benign Het
Cacna1i T C 15: 80,369,662 V700A probably damaging Het
Calcr T C 6: 3,708,511 N225S probably benign Het
Cdh23 A G 10: 60,391,784 S1173P probably damaging Het
Cftr C T 6: 18,320,975 T1428M possibly damaging Het
Chd1l T C 3: 97,572,659 K591E probably benign Het
Chrd C T 16: 20,738,758 P709L possibly damaging Het
Ckap4 T C 10: 84,533,488 R127G possibly damaging Het
Cnbd2 T C 2: 156,367,565 F476S probably benign Het
Dclk3 T C 9: 111,468,648 V420A probably benign Het
Dnah5 A G 15: 28,345,807 D2431G probably benign Het
Duox1 T A 2: 122,315,731 I10N probably benign Het
Ece2 T A 16: 20,617,806 V126D probably damaging Het
Elfn1 T C 5: 139,973,085 Y615H probably damaging Het
Epha1 T C 6: 42,361,482 D720G probably benign Het
Fras1 A G 5: 96,778,159 I3741V probably benign Het
Gm13088 A T 4: 143,656,588 N20K possibly damaging Het
Gm53 A T 11: 96,251,736 noncoding transcript Het
Grb10 G T 11: 11,951,469 probably benign Het
Grid2ip A G 5: 143,382,629 H568R probably damaging Het
Gsap A T 5: 21,287,799 probably null Het
Gse1 T C 8: 120,572,757 probably benign Het
Gstm1 T C 3: 108,016,408 R94G possibly damaging Het
Gtf2ird1 A G 5: 134,362,544 F866L probably damaging Het
Haao T A 17: 83,838,580 probably null Het
Hcn4 A T 9: 58,859,570 I805F unknown Het
Hemk1 A T 9: 107,329,448 probably benign Het
Il12rb1 A T 8: 70,810,588 Y33F possibly damaging Het
Il19 T A 1: 130,935,946 I103F probably damaging Het
Itpr1 A G 6: 108,410,867 N1522S probably benign Het
Klhdc8a A G 1: 132,303,105 Y236C probably damaging Het
Klhl3 C T 13: 58,018,806 G404S probably damaging Het
Large2 T C 2: 92,366,634 probably benign Het
Lgi1 C A 19: 38,306,250 A490E probably damaging Het
Lmbr1 A G 5: 29,323,809 L112P probably damaging Het
Lmo7 T A 14: 101,887,348 probably null Het
Lpin1 A C 12: 16,563,630 I479S possibly damaging Het
Lrrc40 T A 3: 158,066,229 probably benign Het
Lrrc9 A G 12: 72,499,692 N1218S possibly damaging Het
Map3k9 A G 12: 81,724,627 V729A probably benign Het
Marf1 A T 16: 14,128,611 Y1215* probably null Het
Moap1 T A 12: 102,742,565 I242L probably benign Het
Mpo A G 11: 87,796,281 K218E probably benign Het
Mpz C T 1: 171,158,810 R98C probably damaging Het
Neb T G 2: 52,201,980 K5024T probably damaging Het
Nlrp4b C T 7: 10,715,298 T109I probably benign Het
Noc3l T A 19: 38,792,800 probably null Het
Nosip G A 7: 45,076,678 V220I probably benign Het
Nyap1 A C 5: 137,735,578 S398A probably damaging Het
Olfr109 A G 17: 37,466,823 M206V possibly damaging Het
Olfr1240 T G 2: 89,439,623 I219L probably damaging Het
Olfr1278 A G 2: 111,293,143 N292D possibly damaging Het
Osbpl7 T C 11: 97,056,669 probably benign Het
Pard3 A T 8: 127,324,054 Y199F probably damaging Het
Pcdha11 G A 18: 37,011,452 V199I probably benign Het
Pcdhga8 A T 18: 37,726,914 N341I probably damaging Het
Pcsk4 A G 10: 80,325,039 S318P probably damaging Het
Phldb1 C A 9: 44,696,092 R1272L probably damaging Het
Phlpp2 A G 8: 109,877,010 T103A probably damaging Het
Pibf1 T A 14: 99,186,501 Y503* probably null Het
Pkn1 A T 8: 83,684,227 probably null Het
Rbm19 C A 5: 120,132,833 probably benign Het
Rcan1 T C 16: 92,465,906 D5G possibly damaging Het
Recql5 A T 11: 115,928,212 L176Q probably damaging Het
Rev3l T A 10: 39,838,459 L2393Q probably damaging Het
Rp1 C A 1: 4,352,316 K180N probably damaging Het
Rp1 T A 1: 4,352,317 K180M probably damaging Het
Sdk1 T C 5: 142,161,776 V1461A probably benign Het
Sdk2 A T 11: 113,821,382 L1653* probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Skint10 A T 4: 112,746,633 V119D possibly damaging Het
Sncaip T C 18: 52,869,225 S273P probably benign Het
Sp1 T G 15: 102,430,974 I449S probably damaging Het
Spats2 T C 15: 99,174,420 L78P probably damaging Het
Spert C T 14: 75,593,038 E8K probably damaging Het
Stambp T A 6: 83,556,366 N305I probably benign Het
Stim2 A T 5: 54,118,546 S688C probably damaging Het
Sytl3 A G 17: 6,736,581 N355S probably damaging Het
Taf4b C T 18: 14,804,578 A236V probably null Het
Tnfaip6 A G 2: 52,051,074 probably null Het
Trpc2 T A 7: 102,083,969 S416T probably benign Het
Ttn T C 2: 76,738,866 T27228A probably damaging Het
Uhrf1bp1l A T 10: 89,779,963 N156I probably damaging Het
Ush2a T A 1: 188,537,720 D1721E probably benign Het
Usp47 T A 7: 112,082,552 H523Q probably damaging Het
Vmn1r8 A T 6: 57,036,353 I130F probably benign Het
Vps13b A G 15: 35,456,654 S749G probably benign Het
Xrcc5 C A 1: 72,326,265 T283K possibly damaging Het
Ydjc A G 16: 17,148,138 probably benign Het
Other mutations in Ptprf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Ptprf APN 4 118223220 splice site probably benign
IGL01337:Ptprf APN 4 118236291 missense probably damaging 1.00
IGL01482:Ptprf APN 4 118212454 missense probably damaging 1.00
IGL01743:Ptprf APN 4 118248898 critical splice donor site probably null
IGL01987:Ptprf APN 4 118277370 missense probably benign
IGL02189:Ptprf APN 4 118213642 splice site probably benign
IGL03067:Ptprf APN 4 118210713 missense possibly damaging 0.67
PIT4677001:Ptprf UTSW 4 118213612 missense probably damaging 1.00
R0382:Ptprf UTSW 4 118223394 splice site probably benign
R0788:Ptprf UTSW 4 118226466 missense probably damaging 0.97
R1164:Ptprf UTSW 4 118257492 missense probably damaging 1.00
R1478:Ptprf UTSW 4 118212105 nonsense probably null
R1483:Ptprf UTSW 4 118235964 missense possibly damaging 0.81
R1611:Ptprf UTSW 4 118236233 missense probably benign 0.34
R1721:Ptprf UTSW 4 118224899 missense possibly damaging 0.56
R1817:Ptprf UTSW 4 118223265 missense probably benign 0.02
R1818:Ptprf UTSW 4 118209871 missense probably damaging 1.00
R1860:Ptprf UTSW 4 118223932 missense probably damaging 1.00
R2208:Ptprf UTSW 4 118269172 splice site probably benign
R2406:Ptprf UTSW 4 118269304 missense possibly damaging 0.62
R2912:Ptprf UTSW 4 118248980 missense probably damaging 0.98
R3111:Ptprf UTSW 4 118211432 missense probably damaging 1.00
R3498:Ptprf UTSW 4 118224930 missense probably damaging 0.99
R3499:Ptprf UTSW 4 118224930 missense probably damaging 0.99
R3615:Ptprf UTSW 4 118237883 missense probably benign 0.04
R3616:Ptprf UTSW 4 118237883 missense probably benign 0.04
R4038:Ptprf UTSW 4 118257608 missense probably damaging 1.00
R4243:Ptprf UTSW 4 118226452 critical splice donor site probably null
R4260:Ptprf UTSW 4 118226083 missense possibly damaging 0.64
R4693:Ptprf UTSW 4 118211022 missense probably benign 0.16
R4726:Ptprf UTSW 4 118212217 missense possibly damaging 0.86
R4746:Ptprf UTSW 4 118225039 missense possibly damaging 0.83
R4802:Ptprf UTSW 4 118210329 intron probably benign
R5071:Ptprf UTSW 4 118211999 missense probably damaging 1.00
R5221:Ptprf UTSW 4 118225108 missense probably benign 0.00
R5327:Ptprf UTSW 4 118236389 missense probably damaging 1.00
R5336:Ptprf UTSW 4 118235634 missense probably damaging 1.00
R5356:Ptprf UTSW 4 118226338 missense probably benign 0.00
R5373:Ptprf UTSW 4 118226041 missense possibly damaging 0.93
R5555:Ptprf UTSW 4 118224924 missense probably damaging 1.00
R5693:Ptprf UTSW 4 118236177 nonsense probably null
R5860:Ptprf UTSW 4 118211289 intron probably benign
R5869:Ptprf UTSW 4 118210382 missense probably damaging 1.00
R5890:Ptprf UTSW 4 118224735 missense probably benign
R5932:Ptprf UTSW 4 118211767 missense probably benign 0.10
R6028:Ptprf UTSW 4 118213629 missense probably benign 0.01
R6030:Ptprf UTSW 4 118211048 missense probably benign 0.19
R6030:Ptprf UTSW 4 118211048 missense probably benign 0.19
R6088:Ptprf UTSW 4 118210755 missense possibly damaging 0.68
R6089:Ptprf UTSW 4 118211084 missense probably damaging 0.99
R6108:Ptprf UTSW 4 118223256 missense probably benign 0.01
R6320:Ptprf UTSW 4 118212814 missense probably benign
R6741:Ptprf UTSW 4 118223368 missense probably benign 0.00
R6744:Ptprf UTSW 4 118236365 missense probably benign 0.00
R6750:Ptprf UTSW 4 118231731 missense probably benign 0.03
R6906:Ptprf UTSW 4 118269277 missense possibly damaging 0.95
R7021:Ptprf UTSW 4 118223904 missense probably benign 0.00
R7153:Ptprf UTSW 4 118231543 missense probably damaging 1.00
R7326:Ptprf UTSW 4 118231669 missense probably damaging 0.99
R7337:Ptprf UTSW 4 118211125 missense probably damaging 0.99
R7374:Ptprf UTSW 4 118257492 missense probably damaging 1.00
R7375:Ptprf UTSW 4 118212814 missense probably benign
R7399:Ptprf UTSW 4 118226523 missense probably benign 0.28
R7417:Ptprf UTSW 4 118212172 missense probably damaging 1.00
R7448:Ptprf UTSW 4 118235667 missense probably benign 0.03
R7530:Ptprf UTSW 4 118212748 missense probably damaging 1.00
R7593:Ptprf UTSW 4 118212396 missense probably benign 0.00
X0067:Ptprf UTSW 4 118236026 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- ATATCCTCGACCTCAGGTGG -3'
(R):5'- GACATGCTTCTGTGTGCTCAC -3'

Sequencing Primer
(F):5'- ACCTCAGGTGGGACCCAG -3'
(R):5'- GTACACACACCTCCATCTCTGG -3'
Posted On2016-03-01