Incidental Mutation 'R4857:Shroom3'
ID 374043
Institutional Source Beutler Lab
Gene Symbol Shroom3
Ensembl Gene ENSMUSG00000029381
Gene Name shroom family member 3
Synonyms Shrm3, D5Ertd287e, Shrm
MMRRC Submission 042468-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4857 (G1)
Quality Score 142
Status Validated
Chromosome 5
Chromosomal Location 92831294-93113177 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 93090945 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 1151 (V1151F)
Ref Sequence ENSEMBL: ENSMUSP00000153516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113051] [ENSMUST00000113054] [ENSMUST00000113055] [ENSMUST00000168878] [ENSMUST00000172706] [ENSMUST00000225438]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000113051
AA Change: V1057F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108674
Gene: ENSMUSG00000029381
AA Change: V1057F

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 83 93 N/A INTRINSIC
low complexity region 572 586 N/A INTRINSIC
low complexity region 621 639 N/A INTRINSIC
low complexity region 685 704 N/A INTRINSIC
Pfam:ASD1 706 885 2.3e-65 PFAM
low complexity region 939 952 N/A INTRINSIC
low complexity region 1132 1143 N/A INTRINSIC
low complexity region 1172 1184 N/A INTRINSIC
low complexity region 1274 1288 N/A INTRINSIC
low complexity region 1333 1345 N/A INTRINSIC
Pfam:ASD2 1478 1765 3.1e-107 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113054
AA Change: V1057F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108677
Gene: ENSMUSG00000029381
AA Change: V1057F

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 83 93 N/A INTRINSIC
low complexity region 572 586 N/A INTRINSIC
low complexity region 621 639 N/A INTRINSIC
low complexity region 685 704 N/A INTRINSIC
Pfam:ASD1 706 885 2.3e-65 PFAM
low complexity region 939 952 N/A INTRINSIC
low complexity region 1132 1143 N/A INTRINSIC
low complexity region 1172 1184 N/A INTRINSIC
low complexity region 1274 1288 N/A INTRINSIC
low complexity region 1333 1345 N/A INTRINSIC
Pfam:ASD2 1478 1765 3.1e-107 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113055
AA Change: V1232F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108678
Gene: ENSMUSG00000029381
AA Change: V1232F

DomainStartEndE-ValueType
PDZ 35 109 5.81e-11 SMART
low complexity region 191 202 N/A INTRINSIC
low complexity region 258 268 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 860 879 N/A INTRINSIC
Pfam:ASD1 882 1060 1e-57 PFAM
low complexity region 1114 1127 N/A INTRINSIC
low complexity region 1307 1318 N/A INTRINSIC
low complexity region 1347 1359 N/A INTRINSIC
low complexity region 1449 1463 N/A INTRINSIC
low complexity region 1508 1520 N/A INTRINSIC
Pfam:ASD2 1654 1940 9.9e-112 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000168878
AA Change: V1101F
SMART Domains Protein: ENSMUSP00000130419
Gene: ENSMUSG00000029381
AA Change: V1101F

DomainStartEndE-ValueType
PDZ 35 109 5.81e-11 SMART
low complexity region 191 202 N/A INTRINSIC
low complexity region 258 268 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 860 879 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
low complexity region 1176 1187 N/A INTRINSIC
low complexity region 1216 1228 N/A INTRINSIC
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1377 1389 N/A INTRINSIC
Pfam:ASD2 1522 1809 8.9e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172706
SMART Domains Protein: ENSMUSP00000133690
Gene: ENSMUSG00000029381

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 83 93 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201800
Predicted Effect probably damaging
Transcript: ENSMUST00000225438
AA Change: V1151F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.3%
Validation Efficiency 97% (115/119)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PDZ-domain-containing protein that belongs to a family of Shroom-related proteins. This protein may be involved in regulating cell shape in certain tissues. A similar protein in mice is required for proper neurulation. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this locus results in failed neural tube closure leading to exencephaly, acrania, facial clefting, and spina bifida. Homozygotes develop to term but die either at birth or shortly thereafter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548G14Rik C T 15: 46,488,927 (GRCm39) noncoding transcript Het
Aasdh A T 5: 77,035,131 (GRCm39) F428L probably benign Het
Abca13 A G 11: 9,244,143 (GRCm39) N2002S probably benign Het
Acot7 T G 4: 152,322,211 (GRCm39) F248V possibly damaging Het
Acsf2 A G 11: 94,460,164 (GRCm39) I396T probably benign Het
Agbl1 A G 7: 76,069,583 (GRCm39) N372D probably benign Het
Ahctf1 A T 1: 179,626,922 (GRCm39) probably benign Het
Akap11 T C 14: 78,736,300 (GRCm39) D1830G Het
Bcl7b A G 5: 135,202,033 (GRCm39) *59W probably null Het
Bdh1 A G 16: 31,266,366 (GRCm39) probably null Het
Bin3 A G 14: 70,366,344 (GRCm39) N69S probably benign Het
Bltp3b A T 10: 89,615,825 (GRCm39) N156I probably damaging Het
Bsdc1 T C 4: 129,365,685 (GRCm39) probably benign Het
Cacna1i T C 15: 80,253,863 (GRCm39) V700A probably damaging Het
Calcr T C 6: 3,708,511 (GRCm39) N225S probably benign Het
Cby2 C T 14: 75,830,478 (GRCm39) E8K probably damaging Het
Cdh23 A G 10: 60,227,563 (GRCm39) S1173P probably damaging Het
Cftr C T 6: 18,320,974 (GRCm39) T1428M possibly damaging Het
Chd1l T C 3: 97,479,975 (GRCm39) K591E probably benign Het
Chrd C T 16: 20,557,508 (GRCm39) P709L possibly damaging Het
Ckap4 T C 10: 84,369,352 (GRCm39) R127G possibly damaging Het
Cnbd2 T C 2: 156,209,485 (GRCm39) F476S probably benign Het
Dclk3 T C 9: 111,297,716 (GRCm39) V420A probably benign Het
Dnah5 A G 15: 28,345,953 (GRCm39) D2431G probably benign Het
Duox1 T A 2: 122,146,212 (GRCm39) I10N probably benign Het
Ece2 T A 16: 20,436,556 (GRCm39) V126D probably damaging Het
Elfn1 T C 5: 139,958,840 (GRCm39) Y615H probably damaging Het
Epha1 T C 6: 42,338,416 (GRCm39) D720G probably benign Het
Fras1 A G 5: 96,926,018 (GRCm39) I3741V probably benign Het
Gm53 A T 11: 96,142,562 (GRCm39) noncoding transcript Het
Grb10 G T 11: 11,901,469 (GRCm39) probably benign Het
Grid2ip A G 5: 143,368,384 (GRCm39) H568R probably damaging Het
Gsap A T 5: 21,492,797 (GRCm39) probably null Het
Gse1 T C 8: 121,299,496 (GRCm39) probably benign Het
Gstm1 T C 3: 107,923,724 (GRCm39) R94G possibly damaging Het
Gtf2ird1 A G 5: 134,391,398 (GRCm39) F866L probably damaging Het
Haao T A 17: 84,146,009 (GRCm39) probably null Het
Hcn4 A T 9: 58,766,853 (GRCm39) I805F unknown Het
Hemk1 A T 9: 107,206,647 (GRCm39) probably benign Het
Il12rb1 A T 8: 71,263,232 (GRCm39) Y33F possibly damaging Het
Il19 T A 1: 130,863,683 (GRCm39) I103F probably damaging Het
Itpr1 A G 6: 108,387,828 (GRCm39) N1522S probably benign Het
Klhdc8a A G 1: 132,230,843 (GRCm39) Y236C probably damaging Het
Klhl3 C T 13: 58,166,620 (GRCm39) G404S probably damaging Het
Large2 T C 2: 92,196,979 (GRCm39) probably benign Het
Lgi1 C A 19: 38,294,698 (GRCm39) A490E probably damaging Het
Lmbr1 A G 5: 29,528,807 (GRCm39) L112P probably damaging Het
Lmo7 T A 14: 102,124,784 (GRCm39) probably null Het
Lpin1 A C 12: 16,613,631 (GRCm39) I479S possibly damaging Het
Lrrc40 T A 3: 157,771,866 (GRCm39) probably benign Het
Lrrc9 A G 12: 72,546,466 (GRCm39) N1218S possibly damaging Het
Map3k9 A G 12: 81,771,401 (GRCm39) V729A probably benign Het
Marf1 A T 16: 13,946,475 (GRCm39) Y1215* probably null Het
Moap1 T A 12: 102,708,824 (GRCm39) I242L probably benign Het
Mpo A G 11: 87,687,107 (GRCm39) K218E probably benign Het
Mpz C T 1: 170,986,379 (GRCm39) R98C probably damaging Het
Neb T G 2: 52,091,992 (GRCm39) K5024T probably damaging Het
Nlrp4b C T 7: 10,449,225 (GRCm39) T109I probably benign Het
Noc3l T A 19: 38,781,244 (GRCm39) probably null Het
Nosip G A 7: 44,726,102 (GRCm39) V220I probably benign Het
Nyap1 A C 5: 137,733,840 (GRCm39) S398A probably damaging Het
Or12d17 A G 17: 37,777,714 (GRCm39) M206V possibly damaging Het
Or4a68 T G 2: 89,269,967 (GRCm39) I219L probably damaging Het
Or4f54 A G 2: 111,123,488 (GRCm39) N292D possibly damaging Het
Osbpl7 T C 11: 96,947,495 (GRCm39) probably benign Het
Pard3 A T 8: 128,050,535 (GRCm39) Y199F probably damaging Het
Pcdha11 G A 18: 37,144,505 (GRCm39) V199I probably benign Het
Pcdhga8 A T 18: 37,859,967 (GRCm39) N341I probably damaging Het
Pcsk4 A G 10: 80,160,873 (GRCm39) S318P probably damaging Het
Phldb1 C A 9: 44,607,389 (GRCm39) R1272L probably damaging Het
Phlpp2 A G 8: 110,603,642 (GRCm39) T103A probably damaging Het
Pibf1 T A 14: 99,423,937 (GRCm39) Y503* probably null Het
Pkn1 A T 8: 84,410,856 (GRCm39) probably null Het
Pramel22 A T 4: 143,383,158 (GRCm39) N20K possibly damaging Het
Ptprf A G 4: 118,074,394 (GRCm39) probably benign Het
Rbm19 C A 5: 120,270,898 (GRCm39) probably benign Het
Rcan1 T C 16: 92,262,794 (GRCm39) D5G possibly damaging Het
Recql5 A T 11: 115,819,038 (GRCm39) L176Q probably damaging Het
Rev3l T A 10: 39,714,455 (GRCm39) L2393Q probably damaging Het
Rp1 C A 1: 4,422,539 (GRCm39) K180N probably damaging Het
Rp1 T A 1: 4,422,540 (GRCm39) K180M probably damaging Het
Sdk1 T C 5: 142,147,531 (GRCm39) V1461A probably benign Het
Sdk2 A T 11: 113,712,208 (GRCm39) L1653* probably null Het
Skint10 A T 4: 112,603,830 (GRCm39) V119D possibly damaging Het
Sncaip T C 18: 53,002,297 (GRCm39) S273P probably benign Het
Sp1 T G 15: 102,339,409 (GRCm39) I449S probably damaging Het
Spata31h1 T C 10: 82,119,682 (GRCm39) T4443A possibly damaging Het
Spats2 T C 15: 99,072,301 (GRCm39) L78P probably damaging Het
Stambp T A 6: 83,533,348 (GRCm39) N305I probably benign Het
Stim2 A T 5: 54,275,888 (GRCm39) S688C probably damaging Het
Sytl3 A G 17: 7,003,980 (GRCm39) N355S probably damaging Het
Taf4b C T 18: 14,937,635 (GRCm39) A236V probably null Het
Tnfaip6 A G 2: 51,941,086 (GRCm39) probably null Het
Trpc2 T A 7: 101,733,176 (GRCm39) S416T probably benign Het
Ttn T C 2: 76,569,210 (GRCm39) T27228A probably damaging Het
Ush2a T A 1: 188,269,917 (GRCm39) D1721E probably benign Het
Usp47 T A 7: 111,681,759 (GRCm39) H523Q probably damaging Het
Vmn1r8 A T 6: 57,013,338 (GRCm39) I130F probably benign Het
Vps13b A G 15: 35,456,800 (GRCm39) S749G probably benign Het
Xrcc5 C A 1: 72,365,424 (GRCm39) T283K possibly damaging Het
Ydjc A G 16: 16,966,002 (GRCm39) probably benign Het
Other mutations in Shroom3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Shroom3 APN 5 93,098,924 (GRCm39) missense probably damaging 1.00
IGL01086:Shroom3 APN 5 93,096,311 (GRCm39) missense probably benign 0.01
IGL01363:Shroom3 APN 5 93,088,852 (GRCm39) missense probably benign 0.01
IGL01468:Shroom3 APN 5 93,088,201 (GRCm39) missense probably damaging 1.00
IGL01675:Shroom3 APN 5 93,089,539 (GRCm39) missense probably damaging 0.99
IGL01862:Shroom3 APN 5 93,110,148 (GRCm39) missense probably damaging 1.00
IGL01987:Shroom3 APN 5 93,090,048 (GRCm39) missense probably damaging 0.99
IGL02104:Shroom3 APN 5 93,088,248 (GRCm39) missense probably benign 0.32
IGL03248:Shroom3 APN 5 93,100,399 (GRCm39) missense probably benign 0.00
IGL03386:Shroom3 APN 5 93,096,342 (GRCm39) splice site probably benign
R0167:Shroom3 UTSW 5 93,096,254 (GRCm39) splice site probably benign
R0388:Shroom3 UTSW 5 93,099,152 (GRCm39) missense probably benign 0.39
R0395:Shroom3 UTSW 5 92,928,762 (GRCm39) missense probably damaging 1.00
R0567:Shroom3 UTSW 5 93,112,312 (GRCm39) missense possibly damaging 0.53
R1496:Shroom3 UTSW 5 93,090,693 (GRCm39) missense possibly damaging 0.69
R1772:Shroom3 UTSW 5 93,088,515 (GRCm39) missense probably damaging 0.97
R1845:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R1921:Shroom3 UTSW 5 93,110,224 (GRCm39) critical splice donor site probably null
R2059:Shroom3 UTSW 5 92,831,643 (GRCm39) missense probably damaging 1.00
R2203:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2204:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2205:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2301:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2344:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2345:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2346:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2348:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2371:Shroom3 UTSW 5 92,928,729 (GRCm39) missense probably damaging 1.00
R2435:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2829:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2830:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2831:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2897:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2898:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3079:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3080:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3433:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3729:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3730:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3735:Shroom3 UTSW 5 93,112,303 (GRCm39) missense possibly damaging 0.84
R3736:Shroom3 UTSW 5 93,112,303 (GRCm39) missense possibly damaging 0.84
R3851:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3852:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3943:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3969:Shroom3 UTSW 5 93,088,738 (GRCm39) missense probably benign 0.05
R4008:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4009:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4012:Shroom3 UTSW 5 93,096,342 (GRCm39) splice site probably benign
R4154:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4157:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4172:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4173:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4201:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4202:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4204:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4205:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4206:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4284:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4285:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4364:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4384:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4456:Shroom3 UTSW 5 93,088,858 (GRCm39) missense probably benign 0.14
R4707:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4712:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4751:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4755:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4760:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4773:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4774:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4776:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4801:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4802:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4856:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4860:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4860:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4882:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4883:Shroom3 UTSW 5 93,098,993 (GRCm39) missense probably benign 0.14
R4886:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R5262:Shroom3 UTSW 5 93,112,432 (GRCm39) missense probably damaging 1.00
R5271:Shroom3 UTSW 5 93,110,107 (GRCm39) missense probably damaging 1.00
R5719:Shroom3 UTSW 5 93,090,877 (GRCm39) missense probably benign 0.04
R5726:Shroom3 UTSW 5 93,090,864 (GRCm39) missense probably benign 0.00
R5993:Shroom3 UTSW 5 93,088,047 (GRCm39) missense probably damaging 1.00
R6078:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R6079:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R6138:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R6153:Shroom3 UTSW 5 93,112,267 (GRCm39) missense probably damaging 0.99
R6493:Shroom3 UTSW 5 93,089,420 (GRCm39) missense probably benign 0.03
R6495:Shroom3 UTSW 5 93,089,928 (GRCm39) missense possibly damaging 0.66
R6693:Shroom3 UTSW 5 93,088,617 (GRCm39) missense possibly damaging 0.61
R6801:Shroom3 UTSW 5 93,088,795 (GRCm39) missense probably damaging 1.00
R6893:Shroom3 UTSW 5 93,090,063 (GRCm39) missense probably damaging 0.97
R6912:Shroom3 UTSW 5 93,090,876 (GRCm39) missense probably benign 0.02
R6924:Shroom3 UTSW 5 93,112,262 (GRCm39) missense probably damaging 1.00
R7083:Shroom3 UTSW 5 93,112,384 (GRCm39) missense probably damaging 1.00
R7197:Shroom3 UTSW 5 93,090,463 (GRCm39) missense probably damaging 1.00
R7366:Shroom3 UTSW 5 93,112,465 (GRCm39) nonsense probably null
R7712:Shroom3 UTSW 5 93,098,806 (GRCm39) missense probably benign 0.01
R7725:Shroom3 UTSW 5 93,089,512 (GRCm39) missense probably benign 0.19
R7728:Shroom3 UTSW 5 92,831,566 (GRCm39) missense possibly damaging 0.73
R7774:Shroom3 UTSW 5 93,098,348 (GRCm39) missense probably damaging 0.98
R7795:Shroom3 UTSW 5 93,067,508 (GRCm39) missense probably damaging 0.99
R7821:Shroom3 UTSW 5 93,088,705 (GRCm39) missense probably damaging 0.98
R7971:Shroom3 UTSW 5 93,098,933 (GRCm39) missense probably damaging 1.00
R8276:Shroom3 UTSW 5 93,088,339 (GRCm39) missense probably damaging 0.99
R8934:Shroom3 UTSW 5 93,089,584 (GRCm39) missense probably damaging 1.00
R8938:Shroom3 UTSW 5 93,090,930 (GRCm39) missense probably damaging 1.00
R9083:Shroom3 UTSW 5 93,098,533 (GRCm39) missense probably damaging 0.97
R9108:Shroom3 UTSW 5 93,087,975 (GRCm39) missense probably damaging 1.00
R9124:Shroom3 UTSW 5 93,112,401 (GRCm39) missense probably benign 0.19
R9295:Shroom3 UTSW 5 93,098,478 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGGAGCACACTCATCCGTC -3'
(R):5'- TTAACTGTCAGAACGGTAACCAACC -3'

Sequencing Primer
(F):5'- GTGATCGCAGCAGCTCCTTC -3'
(R):5'- AGACATTTATATATCTTTGTGCGGG -3'
Posted On 2016-03-01