Mutagenetix > Incidental Mutation

Incidental Mutation 'R4857:Shroom3'

374043

Institutional Source

Beutler Lab

Gene Symbol

Shroom3

Ensembl Gene

ENSMUSG00000029381

Gene Name

shroom family member 3

Synonyms

D5Ertd287e, Shrm3, Shrm

MMRRC Submission

042468-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4857 (G1)

Quality Score

142

Status

Validated

Chromosome

Chromosomal Location

92683435-92965318 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 92943086 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 1151 (V1151F)

Ref Sequence

ENSEMBL: ENSMUSP00000153516 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113051] [ENSMUST00000113054] [ENSMUST00000113055] [ENSMUST00000168878] [ENSMUST00000172706] [ENSMUST00000225438]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000113051
AA Change: V1057F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000108674
Gene: ENSMUSG00000029381
AA Change: V1057F

Domain	Start	End	E-Value	Type
low complexity region	16	27	N/A	INTRINSIC
low complexity region	83	93	N/A	INTRINSIC
low complexity region	572	586	N/A	INTRINSIC
low complexity region	621	639	N/A	INTRINSIC
low complexity region	685	704	N/A	INTRINSIC
Pfam:ASD1	706	885	2.3e-65	PFAM
low complexity region	939	952	N/A	INTRINSIC
low complexity region	1132	1143	N/A	INTRINSIC
low complexity region	1172	1184	N/A	INTRINSIC
low complexity region	1274	1288	N/A	INTRINSIC
low complexity region	1333	1345	N/A	INTRINSIC
Pfam:ASD2	1478	1765	3.1e-107	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000113054
AA Change: V1057F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000108677
Gene: ENSMUSG00000029381
AA Change: V1057F

Domain	Start	End	E-Value	Type
low complexity region	16	27	N/A	INTRINSIC
low complexity region	83	93	N/A	INTRINSIC
low complexity region	572	586	N/A	INTRINSIC
low complexity region	621	639	N/A	INTRINSIC
low complexity region	685	704	N/A	INTRINSIC
Pfam:ASD1	706	885	2.3e-65	PFAM
low complexity region	939	952	N/A	INTRINSIC
low complexity region	1132	1143	N/A	INTRINSIC
low complexity region	1172	1184	N/A	INTRINSIC
low complexity region	1274	1288	N/A	INTRINSIC
low complexity region	1333	1345	N/A	INTRINSIC
Pfam:ASD2	1478	1765	3.1e-107	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000113055
AA Change: V1232F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000108678
Gene: ENSMUSG00000029381
AA Change: V1232F

Domain	Start	End	E-Value	Type
PDZ	35	109	5.81e-11	SMART
low complexity region	191	202	N/A	INTRINSIC
low complexity region	258	268	N/A	INTRINSIC
low complexity region	747	761	N/A	INTRINSIC
low complexity region	796	814	N/A	INTRINSIC
low complexity region	860	879	N/A	INTRINSIC
Pfam:ASD1	882	1060	1e-57	PFAM
low complexity region	1114	1127	N/A	INTRINSIC
low complexity region	1307	1318	N/A	INTRINSIC
low complexity region	1347	1359	N/A	INTRINSIC
low complexity region	1449	1463	N/A	INTRINSIC
low complexity region	1508	1520	N/A	INTRINSIC
Pfam:ASD2	1654	1940	9.9e-112	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000168878
AA Change: V1101F

SMART Domains

Protein: ENSMUSP00000130419
Gene: ENSMUSG00000029381
AA Change: V1101F

Domain	Start	End	E-Value	Type
PDZ	35	109	5.81e-11	SMART
low complexity region	191	202	N/A	INTRINSIC
low complexity region	258	268	N/A	INTRINSIC
low complexity region	747	761	N/A	INTRINSIC
low complexity region	796	814	N/A	INTRINSIC
low complexity region	860	879	N/A	INTRINSIC
low complexity region	983	996	N/A	INTRINSIC
low complexity region	1176	1187	N/A	INTRINSIC
low complexity region	1216	1228	N/A	INTRINSIC
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1377	1389	N/A	INTRINSIC
Pfam:ASD2	1522	1809	8.9e-108	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000172706

SMART Domains

Protein: ENSMUSP00000133690
Gene: ENSMUSG00000029381

Domain	Start	End	E-Value	Type
low complexity region	16	27	N/A	INTRINSIC
low complexity region	83	93	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200869

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201800

Predicted Effect

probably damaging
Transcript: ENSMUST00000225438
AA Change: V1151F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.3%

Validation Efficiency

97% (115/119)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PDZ-domain-containing protein that belongs to a family of Shroom-related proteins. This protein may be involved in regulating cell shape in certain tissues. A similar protein in mice is required for proper neurulation. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this locus results in failed neural tube closure leading to exencephaly, acrania, facial clefting, and spina bifida. Homozygotes develop to term but die either at birth or shortly thereafter. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930548G14Rik	C	T	15: 46,625,531		noncoding transcript	Het
4932415D10Rik	T	C	10: 82,283,848	T4443A	possibly damaging	Het
Aasdh	A	T	5: 76,887,284	F428L	probably benign	Het
Abca13	A	G	11: 9,294,143	N2002S	probably benign	Het
Acot7	T	G	4: 152,237,754	F248V	possibly damaging	Het
Acsf2	A	G	11: 94,569,338	I396T	probably benign	Het
Agbl1	A	G	7: 76,419,835	N372D	probably benign	Het
Ahctf1	A	T	1: 179,799,357		probably benign	Het
Akap11	T	C	14: 78,498,860	D1830G		Het
Bcl7b	A	G	5: 135,173,179	*59W	probably null	Het
Bdh1	A	G	16: 31,447,548		probably null	Het
Bin3	A	G	14: 70,128,895	N69S	probably benign	Het
Bsdc1	T	C	4: 129,471,892		probably benign	Het
Cacna1i	T	C	15: 80,369,662	V700A	probably damaging	Het
Calcr	T	C	6: 3,708,511	N225S	probably benign	Het
Cdh23	A	G	10: 60,391,784	S1173P	probably damaging	Het
Cftr	C	T	6: 18,320,975	T1428M	possibly damaging	Het
Chd1l	T	C	3: 97,572,659	K591E	probably benign	Het
Chrd	C	T	16: 20,738,758	P709L	possibly damaging	Het
Ckap4	T	C	10: 84,533,488	R127G	possibly damaging	Het
Cnbd2	T	C	2: 156,367,565	F476S	probably benign	Het
Dclk3	T	C	9: 111,468,648	V420A	probably benign	Het
Dnah5	A	G	15: 28,345,807	D2431G	probably benign	Het
Duox1	T	A	2: 122,315,731	I10N	probably benign	Het
Ece2	T	A	16: 20,617,806	V126D	probably damaging	Het
Elfn1	T	C	5: 139,973,085	Y615H	probably damaging	Het
Epha1	T	C	6: 42,361,482	D720G	probably benign	Het
Fras1	A	G	5: 96,778,159	I3741V	probably benign	Het
Gm13088	A	T	4: 143,656,588	N20K	possibly damaging	Het
Gm53	A	T	11: 96,251,736		noncoding transcript	Het
Grb10	G	T	11: 11,951,469		probably benign	Het
Grid2ip	A	G	5: 143,382,629	H568R	probably damaging	Het
Gsap	A	T	5: 21,287,799		probably null	Het
Gse1	T	C	8: 120,572,757		probably benign	Het
Gstm1	T	C	3: 108,016,408	R94G	possibly damaging	Het
Gtf2ird1	A	G	5: 134,362,544	F866L	probably damaging	Het
Haao	T	A	17: 83,838,580		probably null	Het
Hcn4	A	T	9: 58,859,570	I805F	unknown	Het
Hemk1	A	T	9: 107,329,448		probably benign	Het
Il12rb1	A	T	8: 70,810,588	Y33F	possibly damaging	Het
Il19	T	A	1: 130,935,946	I103F	probably damaging	Het
Itpr1	A	G	6: 108,410,867	N1522S	probably benign	Het
Klhdc8a	A	G	1: 132,303,105	Y236C	probably damaging	Het
Klhl3	C	T	13: 58,018,806	G404S	probably damaging	Het
Large2	T	C	2: 92,366,634		probably benign	Het
Lgi1	C	A	19: 38,306,250	A490E	probably damaging	Het
Lmbr1	A	G	5: 29,323,809	L112P	probably damaging	Het
Lmo7	T	A	14: 101,887,348		probably null	Het
Lpin1	A	C	12: 16,563,630	I479S	possibly damaging	Het
Lrrc40	T	A	3: 158,066,229		probably benign	Het
Lrrc9	A	G	12: 72,499,692	N1218S	possibly damaging	Het
Map3k9	A	G	12: 81,724,627	V729A	probably benign	Het
Marf1	A	T	16: 14,128,611	Y1215*	probably null	Het
Moap1	T	A	12: 102,742,565	I242L	probably benign	Het
Mpo	A	G	11: 87,796,281	K218E	probably benign	Het
Mpz	C	T	1: 171,158,810	R98C	probably damaging	Het
Neb	T	G	2: 52,201,980	K5024T	probably damaging	Het
Nlrp4b	C	T	7: 10,715,298	T109I	probably benign	Het
Noc3l	T	A	19: 38,792,800		probably null	Het
Nosip	G	A	7: 45,076,678	V220I	probably benign	Het
Nyap1	A	C	5: 137,735,578	S398A	probably damaging	Het
Olfr109	A	G	17: 37,466,823	M206V	possibly damaging	Het
Olfr1240	T	G	2: 89,439,623	I219L	probably damaging	Het
Olfr1278	A	G	2: 111,293,143	N292D	possibly damaging	Het
Osbpl7	T	C	11: 97,056,669		probably benign	Het
Pard3	A	T	8: 127,324,054	Y199F	probably damaging	Het
Pcdha11	G	A	18: 37,011,452	V199I	probably benign	Het
Pcdhga8	A	T	18: 37,726,914	N341I	probably damaging	Het
Pcsk4	A	G	10: 80,325,039	S318P	probably damaging	Het
Phldb1	C	A	9: 44,696,092	R1272L	probably damaging	Het
Phlpp2	A	G	8: 109,877,010	T103A	probably damaging	Het
Pibf1	T	A	14: 99,186,501	Y503*	probably null	Het
Pkn1	A	T	8: 83,684,227		probably null	Het
Ptprf	A	G	4: 118,217,197		probably benign	Het
Rbm19	C	A	5: 120,132,833		probably benign	Het
Rcan1	T	C	16: 92,465,906	D5G	possibly damaging	Het
Recql5	A	T	11: 115,928,212	L176Q	probably damaging	Het
Rev3l	T	A	10: 39,838,459	L2393Q	probably damaging	Het
Rp1	C	A	1: 4,352,316	K180N	probably damaging	Het
Rp1	T	A	1: 4,352,317	K180M	probably damaging	Het
Sdk1	T	C	5: 142,161,776	V1461A	probably benign	Het
Sdk2	A	T	11: 113,821,382	L1653*	probably null	Het
Skint10	A	T	4: 112,746,633	V119D	possibly damaging	Het
Sncaip	T	C	18: 52,869,225	S273P	probably benign	Het
Sp1	T	G	15: 102,430,974	I449S	probably damaging	Het
Spats2	T	C	15: 99,174,420	L78P	probably damaging	Het
Spert	C	T	14: 75,593,038	E8K	probably damaging	Het
Stambp	T	A	6: 83,556,366	N305I	probably benign	Het
Stim2	A	T	5: 54,118,546	S688C	probably damaging	Het
Sytl3	A	G	17: 6,736,581	N355S	probably damaging	Het
Taf4b	C	T	18: 14,804,578	A236V	probably null	Het
Tnfaip6	A	G	2: 52,051,074		probably null	Het
Trpc2	T	A	7: 102,083,969	S416T	probably benign	Het
Ttn	T	C	2: 76,738,866	T27228A	probably damaging	Het
Uhrf1bp1l	A	T	10: 89,779,963	N156I	probably damaging	Het
Ush2a	T	A	1: 188,537,720	D1721E	probably benign	Het
Usp47	T	A	7: 112,082,552	H523Q	probably damaging	Het
Vmn1r8	A	T	6: 57,036,353	I130F	probably benign	Het
Vps13b	A	G	15: 35,456,654	S749G	probably benign	Het
Xrcc5	C	A	1: 72,326,265	T283K	possibly damaging	Het
Ydjc	A	G	16: 17,148,138		probably benign	Het

Other mutations in Shroom3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00850:Shroom3	APN	5	92951065	missense	probably damaging	1.00
IGL01086:Shroom3	APN	5	92948452	missense	probably benign	0.01
IGL01363:Shroom3	APN	5	92940993	missense	probably benign	0.01
IGL01468:Shroom3	APN	5	92940342	missense	probably damaging	1.00
IGL01675:Shroom3	APN	5	92941680	missense	probably damaging	0.99
IGL01862:Shroom3	APN	5	92962289	missense	probably damaging	1.00
IGL01987:Shroom3	APN	5	92942189	missense	probably damaging	0.99
IGL02104:Shroom3	APN	5	92940389	missense	probably benign	0.32
IGL03248:Shroom3	APN	5	92952540	missense	probably benign	0.00
IGL03386:Shroom3	APN	5	92948483	splice site	probably benign
R0167:Shroom3	UTSW	5	92948395	splice site	probably benign
R0388:Shroom3	UTSW	5	92951293	missense	probably benign	0.39
R0395:Shroom3	UTSW	5	92780903	missense	probably damaging	1.00
R0567:Shroom3	UTSW	5	92964453	missense	possibly damaging	0.53
R1496:Shroom3	UTSW	5	92942834	missense	possibly damaging	0.69
R1772:Shroom3	UTSW	5	92940656	missense	probably damaging	0.97
R1845:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R1921:Shroom3	UTSW	5	92962365	critical splice donor site	probably null
R2059:Shroom3	UTSW	5	92683784	missense	probably damaging	1.00
R2203:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2204:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2205:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2301:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2344:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2345:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2346:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2348:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2371:Shroom3	UTSW	5	92780870	missense	probably damaging	1.00
R2435:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2829:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2830:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2831:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2897:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2898:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3079:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3080:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3433:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3729:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3730:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3735:Shroom3	UTSW	5	92964444	missense	possibly damaging	0.84
R3736:Shroom3	UTSW	5	92964444	missense	possibly damaging	0.84
R3851:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3852:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3943:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3969:Shroom3	UTSW	5	92940879	missense	probably benign	0.05
R4008:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4009:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4012:Shroom3	UTSW	5	92948483	splice site	probably benign
R4154:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4157:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4172:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4173:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4201:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4202:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4204:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4205:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4206:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4284:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4285:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4364:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4384:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4456:Shroom3	UTSW	5	92940999	missense	probably benign	0.14
R4707:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4712:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4751:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4755:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4760:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4773:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4774:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4776:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4801:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4802:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4856:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4860:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4860:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4882:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4883:Shroom3	UTSW	5	92951134	missense	probably benign	0.14
R4886:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R5262:Shroom3	UTSW	5	92964573	missense	probably damaging	1.00
R5271:Shroom3	UTSW	5	92962248	missense	probably damaging	1.00
R5719:Shroom3	UTSW	5	92943018	missense	probably benign	0.04
R5726:Shroom3	UTSW	5	92943005	missense	probably benign	0.00
R5993:Shroom3	UTSW	5	92940188	missense	probably damaging	1.00
R6078:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6079:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6138:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6153:Shroom3	UTSW	5	92964408	missense	probably damaging	0.99
R6493:Shroom3	UTSW	5	92941561	missense	probably benign	0.03
R6495:Shroom3	UTSW	5	92942069	missense	possibly damaging	0.66
R6693:Shroom3	UTSW	5	92940758	missense	possibly damaging	0.61
R6801:Shroom3	UTSW	5	92940936	missense	probably damaging	1.00
R6893:Shroom3	UTSW	5	92942204	missense	probably damaging	0.97
R6912:Shroom3	UTSW	5	92943017	missense	probably benign	0.02
R6924:Shroom3	UTSW	5	92964403	missense	probably damaging	1.00
R7083:Shroom3	UTSW	5	92964525	missense	probably damaging	1.00
R7197:Shroom3	UTSW	5	92942604	missense	probably damaging	1.00
R7366:Shroom3	UTSW	5	92964606	nonsense	probably null
R7712:Shroom3	UTSW	5	92950947	missense	probably benign	0.01
R7725:Shroom3	UTSW	5	92941653	missense	probably benign	0.19
R7728:Shroom3	UTSW	5	92683707	missense	possibly damaging	0.73
R7774:Shroom3	UTSW	5	92950489	missense	probably damaging	0.98
R7795:Shroom3	UTSW	5	92919649	missense	probably damaging	0.99
R7821:Shroom3	UTSW	5	92940846	missense	probably damaging	0.98
R7971:Shroom3	UTSW	5	92951074	missense	probably damaging	1.00
R8276:Shroom3	UTSW	5	92940480	missense	probably damaging	0.99
R8934:Shroom3	UTSW	5	92941725	missense	probably damaging	1.00
R8938:Shroom3	UTSW	5	92943071	missense	probably damaging	1.00
R9083:Shroom3	UTSW	5	92950674	missense	probably damaging	0.97
R9108:Shroom3	UTSW	5	92940116	missense	probably damaging	1.00
R9124:Shroom3	UTSW	5	92964542	missense	probably benign	0.19
R9295:Shroom3	UTSW	5	92950619	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AAGGAGCACACTCATCCGTC -3'
(R):5'- TTAACTGTCAGAACGGTAACCAACC -3'

Sequencing Primer
(F):5'- GTGATCGCAGCAGCTCCTTC -3'
(R):5'- AGACATTTATATATCTTTGTGCGGG -3'

Posted On

2016-03-01