Incidental Mutation 'R4857:Agbl1'
ID374060
Institutional Source Beutler Lab
Gene Symbol Agbl1
Ensembl Gene ENSMUSG00000025754
Gene NameATP/GTP binding protein-like 1
SynonymsNna1-l1, EG244071
MMRRC Submission 042468-MU
Accession Numbers

Ncbi RefSeq: NM_001199224.1; MGI:3646469

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4857 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location76229887-77124698 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76419835 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 372 (N372D)
Ref Sequence ENSEMBL: ENSMUSP00000119721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026854] [ENSMUST00000107442] [ENSMUST00000156166]
Predicted Effect probably benign
Transcript: ENSMUST00000026854
AA Change: N120D

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000026854
Gene: ENSMUSG00000025754
AA Change: N120D

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Pfam:Peptidase_M14 493 631 4.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107442
AA Change: N120D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000103066
Gene: ENSMUSG00000025754
AA Change: N120D

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Pfam:Peptidase_M14 494 754 3.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156166
AA Change: N372D

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000119721
Gene: ENSMUSG00000025754
AA Change: N372D

DomainStartEndE-ValueType
low complexity region 254 270 N/A INTRINSIC
Meta Mutation Damage Score 0.0715 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.3%
Validation Efficiency 97% (115/119)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyglutamylation is a reversible posttranslational modification catalyzed by polyglutamylases that results in the addition of glutamate side chains on the modified protein. This gene encodes a glutamate decarboxylase that catalyzes the deglutamylation of polyglutamylated proteins. Mutations in this gene result in dominant late-onset Fuchs corneal dystrophy. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548G14Rik C T 15: 46,625,531 noncoding transcript Het
4932415D10Rik T C 10: 82,283,848 T4443A possibly damaging Het
Aasdh A T 5: 76,887,284 F428L probably benign Het
Abca13 A G 11: 9,294,143 N2002S probably benign Het
Acot7 T G 4: 152,237,754 F248V possibly damaging Het
Acsf2 A G 11: 94,569,338 I396T probably benign Het
Ahctf1 A T 1: 179,799,357 probably benign Het
Akap11 T C 14: 78,498,860 D1830G Het
Bcl7b A G 5: 135,173,179 *59W probably null Het
Bdh1 A G 16: 31,447,548 probably null Het
Bin3 A G 14: 70,128,895 N69S probably benign Het
Bsdc1 T C 4: 129,471,892 probably benign Het
Cacna1i T C 15: 80,369,662 V700A probably damaging Het
Calcr T C 6: 3,708,511 N225S probably benign Het
Cdh23 A G 10: 60,391,784 S1173P probably damaging Het
Cftr C T 6: 18,320,975 T1428M possibly damaging Het
Chd1l T C 3: 97,572,659 K591E probably benign Het
Chrd C T 16: 20,738,758 P709L possibly damaging Het
Ckap4 T C 10: 84,533,488 R127G possibly damaging Het
Cnbd2 T C 2: 156,367,565 F476S probably benign Het
Dclk3 T C 9: 111,468,648 V420A probably benign Het
Dnah5 A G 15: 28,345,807 D2431G probably benign Het
Duox1 T A 2: 122,315,731 I10N probably benign Het
Ece2 T A 16: 20,617,806 V126D probably damaging Het
Elfn1 T C 5: 139,973,085 Y615H probably damaging Het
Epha1 T C 6: 42,361,482 D720G probably benign Het
Fras1 A G 5: 96,778,159 I3741V probably benign Het
Gm13088 A T 4: 143,656,588 N20K possibly damaging Het
Gm53 A T 11: 96,251,736 noncoding transcript Het
Grb10 G T 11: 11,951,469 probably benign Het
Grid2ip A G 5: 143,382,629 H568R probably damaging Het
Gsap A T 5: 21,287,799 probably null Het
Gse1 T C 8: 120,572,757 probably benign Het
Gstm1 T C 3: 108,016,408 R94G possibly damaging Het
Gtf2ird1 A G 5: 134,362,544 F866L probably damaging Het
Haao T A 17: 83,838,580 probably null Het
Hcn4 A T 9: 58,859,570 I805F unknown Het
Hemk1 A T 9: 107,329,448 probably benign Het
Il12rb1 A T 8: 70,810,588 Y33F possibly damaging Het
Il19 T A 1: 130,935,946 I103F probably damaging Het
Itpr1 A G 6: 108,410,867 N1522S probably benign Het
Klhdc8a A G 1: 132,303,105 Y236C probably damaging Het
Klhl3 C T 13: 58,018,806 G404S probably damaging Het
Large2 T C 2: 92,366,634 probably benign Het
Lgi1 C A 19: 38,306,250 A490E probably damaging Het
Lmbr1 A G 5: 29,323,809 L112P probably damaging Het
Lmo7 T A 14: 101,887,348 probably null Het
Lpin1 A C 12: 16,563,630 I479S possibly damaging Het
Lrrc40 T A 3: 158,066,229 probably benign Het
Lrrc9 A G 12: 72,499,692 N1218S possibly damaging Het
Map3k9 A G 12: 81,724,627 V729A probably benign Het
Marf1 A T 16: 14,128,611 Y1215* probably null Het
Moap1 T A 12: 102,742,565 I242L probably benign Het
Mpo A G 11: 87,796,281 K218E probably benign Het
Mpz C T 1: 171,158,810 R98C probably damaging Het
Neb T G 2: 52,201,980 K5024T probably damaging Het
Nlrp4b C T 7: 10,715,298 T109I probably benign Het
Noc3l T A 19: 38,792,800 probably null Het
Nosip G A 7: 45,076,678 V220I probably benign Het
Nyap1 A C 5: 137,735,578 S398A probably damaging Het
Olfr109 A G 17: 37,466,823 M206V possibly damaging Het
Olfr1240 T G 2: 89,439,623 I219L probably damaging Het
Olfr1278 A G 2: 111,293,143 N292D possibly damaging Het
Osbpl7 T C 11: 97,056,669 probably benign Het
Pard3 A T 8: 127,324,054 Y199F probably damaging Het
Pcdha11 G A 18: 37,011,452 V199I probably benign Het
Pcdhga8 A T 18: 37,726,914 N341I probably damaging Het
Pcsk4 A G 10: 80,325,039 S318P probably damaging Het
Phldb1 C A 9: 44,696,092 R1272L probably damaging Het
Phlpp2 A G 8: 109,877,010 T103A probably damaging Het
Pibf1 T A 14: 99,186,501 Y503* probably null Het
Pkn1 A T 8: 83,684,227 probably null Het
Ptprf A G 4: 118,217,197 probably benign Het
Rbm19 C A 5: 120,132,833 probably benign Het
Rcan1 T C 16: 92,465,906 D5G possibly damaging Het
Recql5 A T 11: 115,928,212 L176Q probably damaging Het
Rev3l T A 10: 39,838,459 L2393Q probably damaging Het
Rp1 C A 1: 4,352,316 K180N probably damaging Het
Rp1 T A 1: 4,352,317 K180M probably damaging Het
Sdk1 T C 5: 142,161,776 V1461A probably benign Het
Sdk2 A T 11: 113,821,382 L1653* probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Skint10 A T 4: 112,746,633 V119D possibly damaging Het
Sncaip T C 18: 52,869,225 S273P probably benign Het
Sp1 T G 15: 102,430,974 I449S probably damaging Het
Spats2 T C 15: 99,174,420 L78P probably damaging Het
Spert C T 14: 75,593,038 E8K probably damaging Het
Stambp T A 6: 83,556,366 N305I probably benign Het
Stim2 A T 5: 54,118,546 S688C probably damaging Het
Sytl3 A G 17: 6,736,581 N355S probably damaging Het
Taf4b C T 18: 14,804,578 A236V probably null Het
Tnfaip6 A G 2: 52,051,074 probably null Het
Trpc2 T A 7: 102,083,969 S416T probably benign Het
Ttn T C 2: 76,738,866 T27228A probably damaging Het
Uhrf1bp1l A T 10: 89,779,963 N156I probably damaging Het
Ush2a T A 1: 188,537,720 D1721E probably benign Het
Usp47 T A 7: 112,082,552 H523Q probably damaging Het
Vmn1r8 A T 6: 57,036,353 I130F probably benign Het
Vps13b A G 15: 35,456,654 S749G probably benign Het
Xrcc5 C A 1: 72,326,265 T283K possibly damaging Het
Ydjc A G 16: 17,148,138 probably benign Het
Other mutations in Agbl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01567:Agbl1 APN 7 76421880 missense probably benign 0.01
IGL01650:Agbl1 APN 7 76420319 missense probably damaging 1.00
IGL02244:Agbl1 APN 7 76766372 missense probably damaging 1.00
IGL03088:Agbl1 APN 7 76720142 missense probably benign 0.12
IGL03143:Agbl1 APN 7 76420045 nonsense probably null
IGL03306:Agbl1 APN 7 76589504 missense probably damaging 1.00
R0001:Agbl1 UTSW 7 76419863 missense probably damaging 0.98
R0045:Agbl1 UTSW 7 76698840 critical splice donor site probably null
R0045:Agbl1 UTSW 7 76698840 critical splice donor site probably null
R0541:Agbl1 UTSW 7 76409245 missense probably benign 0.22
R1889:Agbl1 UTSW 7 76589381 missense probably damaging 1.00
R2089:Agbl1 UTSW 7 76589500 missense probably damaging 0.98
R2091:Agbl1 UTSW 7 76589500 missense probably damaging 0.98
R2091:Agbl1 UTSW 7 76589500 missense probably damaging 0.98
R2127:Agbl1 UTSW 7 76419880 missense possibly damaging 0.64
R2148:Agbl1 UTSW 7 76414717 splice site probably null
R2229:Agbl1 UTSW 7 76433378 missense probably benign 0.43
R2243:Agbl1 UTSW 7 76418722 missense possibly damaging 0.93
R2255:Agbl1 UTSW 7 76422184 missense probably damaging 1.00
R2411:Agbl1 UTSW 7 76720150 missense probably damaging 1.00
R2426:Agbl1 UTSW 7 76421902 missense probably damaging 1.00
R2508:Agbl1 UTSW 7 76589550 critical splice donor site probably null
R2910:Agbl1 UTSW 7 76419838 missense probably benign 0.13
R2919:Agbl1 UTSW 7 76414658 missense probably damaging 1.00
R3056:Agbl1 UTSW 7 76766484 missense possibly damaging 0.60
R3153:Agbl1 UTSW 7 76720196 missense probably damaging 1.00
R3770:Agbl1 UTSW 7 76425929 critical splice donor site probably null
R3825:Agbl1 UTSW 7 76419967 missense probably damaging 0.99
R4632:Agbl1 UTSW 7 76413685 missense probably benign 0.00
R4943:Agbl1 UTSW 7 76420016 missense probably benign 0.01
R5055:Agbl1 UTSW 7 76413577 missense probably damaging 1.00
R5071:Agbl1 UTSW 7 76421917 missense probably damaging 1.00
R5072:Agbl1 UTSW 7 76421917 missense probably damaging 1.00
R5074:Agbl1 UTSW 7 76421917 missense probably damaging 1.00
R5095:Agbl1 UTSW 7 76720133 missense probably damaging 0.96
R5133:Agbl1 UTSW 7 76422156 missense probably benign 0.21
R5576:Agbl1 UTSW 7 76335237 missense probably benign 0.03
R5665:Agbl1 UTSW 7 76589503 missense probably damaging 1.00
R5849:Agbl1 UTSW 7 76325098 missense probably benign 0.35
R5924:Agbl1 UTSW 7 76409234 missense probably benign 0.12
R6044:Agbl1 UTSW 7 76318120 missense possibly damaging 0.56
R6117:Agbl1 UTSW 7 76698786 missense probably damaging 1.00
R6144:Agbl1 UTSW 7 76420084 missense probably benign 0.02
R6368:Agbl1 UTSW 7 76419830 missense probably benign 0.25
R6806:Agbl1 UTSW 7 76425921 missense probably damaging 1.00
R7455:Agbl1 UTSW 7 76424755 missense unknown
R7459:Agbl1 UTSW 7 76420066 missense not run
R7485:Agbl1 UTSW 7 76589493 missense unknown
R7516:Agbl1 UTSW 7 76425921 missense probably damaging 1.00
R7539:Agbl1 UTSW 7 76425929 critical splice donor site probably null
R7561:Agbl1 UTSW 7 76698761 missense unknown
R7630:Agbl1 UTSW 7 76886156 missense unknown
R7655:Agbl1 UTSW 7 76409332 missense
R7656:Agbl1 UTSW 7 76409332 missense
R7658:Agbl1 UTSW 7 76766369 missense unknown
R7681:Agbl1 UTSW 7 76444901 missense unknown
R7694:Agbl1 UTSW 7 76698765 missense unknown
R7773:Agbl1 UTSW 7 76698837 missense unknown
R8208:Agbl1 UTSW 7 76720168 missense unknown
R8317:Agbl1 UTSW 7 76422181 missense unknown
Z1088:Agbl1 UTSW 7 76419904 missense probably benign 0.00
Z1176:Agbl1 UTSW 7 76418685 missense
Z1177:Agbl1 UTSW 7 76720206 missense unknown
Predicted Primers PCR Primer
(F):5'- CGATTCATCCAAAGTCTCTTCTGAG -3'
(R):5'- GTTTTGAGGATGACGGTACACC -3'

Sequencing Primer
(F):5'- AGAGCGACTTTTGTGAGACTC -3'
(R):5'- GGTACACCGGACTTCCCTGTC -3'
Posted On2016-03-01