Mutagenetix > Incidental Mutation

Incidental Mutation 'R4857:Sdk2'

374083

Institutional Source

Beutler Lab

Gene Symbol

Sdk2

Ensembl Gene

ENSMUSG00000041592

Gene Name

sidekick cell adhesion molecule 2

Synonyms

5330435L01Rik, 4632412F08Rik

MMRRC Submission

042468-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R4857 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

113776374-114067046 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 113821382 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 1653 (L1653*)

Ref Sequence

ENSEMBL: ENSMUSP00000038972 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041627]

AlphaFold

Q6V4S5

Predicted Effect

probably null
Transcript: ENSMUST00000041627
AA Change: L1653*

SMART Domains

Protein: ENSMUSP00000038972
Gene: ENSMUSG00000041592
AA Change: L1653*

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGc2	43	102	4.67e-4	SMART
IG	123	208	6.07e-3	SMART
IG	225	309	1.4e-7	SMART
IGc2	325	391	6.21e-9	SMART
IGc2	418	486	8.57e-12	SMART
IG	506	591	2.37e-5	SMART
FN3	594	678	1.91e-7	SMART
FN3	694	780	2.42e-9	SMART
FN3	796	884	3.45e-5	SMART
FN3	899	981	2.36e-12	SMART
FN3	997	1084	1.64e-6	SMART
FN3	1101	1188	8.83e-12	SMART
FN3	1204	1289	3.62e-8	SMART
FN3	1305	1388	1.74e-10	SMART
FN3	1404	1489	8.23e-12	SMART
FN3	1506	1612	3.62e-8	SMART
FN3	1628	1713	1.15e-10	SMART
FN3	1728	1815	2.17e-11	SMART
FN3	1829	1913	5.04e-7	SMART
transmembrane domain	1935	1957	N/A	INTRINSIC
low complexity region	2138	2153	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125879

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.3%

Validation Efficiency

97% (115/119)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains two immunoglobulin domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. This protein, and a homologous mouse sequence, are very similar to the Drosophila sidekick gene product but the specific function of this superfamily member is not yet known. Evidence for alternative splicing at this gene locus has been observed but the full-length nature of additional variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired interconnectvity between VG3 amacrine cells and W3B retinal ganglion cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930548G14Rik	C	T	15: 46,625,531		noncoding transcript	Het
4932415D10Rik	T	C	10: 82,283,848	T4443A	possibly damaging	Het
Aasdh	A	T	5: 76,887,284	F428L	probably benign	Het
Abca13	A	G	11: 9,294,143	N2002S	probably benign	Het
Acot7	T	G	4: 152,237,754	F248V	possibly damaging	Het
Acsf2	A	G	11: 94,569,338	I396T	probably benign	Het
Agbl1	A	G	7: 76,419,835	N372D	probably benign	Het
Ahctf1	A	T	1: 179,799,357		probably benign	Het
Akap11	T	C	14: 78,498,860	D1830G		Het
Bcl7b	A	G	5: 135,173,179	*59W	probably null	Het
Bdh1	A	G	16: 31,447,548		probably null	Het
Bin3	A	G	14: 70,128,895	N69S	probably benign	Het
Bsdc1	T	C	4: 129,471,892		probably benign	Het
Cacna1i	T	C	15: 80,369,662	V700A	probably damaging	Het
Calcr	T	C	6: 3,708,511	N225S	probably benign	Het
Cdh23	A	G	10: 60,391,784	S1173P	probably damaging	Het
Cftr	C	T	6: 18,320,975	T1428M	possibly damaging	Het
Chd1l	T	C	3: 97,572,659	K591E	probably benign	Het
Chrd	C	T	16: 20,738,758	P709L	possibly damaging	Het
Ckap4	T	C	10: 84,533,488	R127G	possibly damaging	Het
Cnbd2	T	C	2: 156,367,565	F476S	probably benign	Het
Dclk3	T	C	9: 111,468,648	V420A	probably benign	Het
Dnah5	A	G	15: 28,345,807	D2431G	probably benign	Het
Duox1	T	A	2: 122,315,731	I10N	probably benign	Het
Ece2	T	A	16: 20,617,806	V126D	probably damaging	Het
Elfn1	T	C	5: 139,973,085	Y615H	probably damaging	Het
Epha1	T	C	6: 42,361,482	D720G	probably benign	Het
Fras1	A	G	5: 96,778,159	I3741V	probably benign	Het
Gm13088	A	T	4: 143,656,588	N20K	possibly damaging	Het
Gm53	A	T	11: 96,251,736		noncoding transcript	Het
Grb10	G	T	11: 11,951,469		probably benign	Het
Grid2ip	A	G	5: 143,382,629	H568R	probably damaging	Het
Gsap	A	T	5: 21,287,799		probably null	Het
Gse1	T	C	8: 120,572,757		probably benign	Het
Gstm1	T	C	3: 108,016,408	R94G	possibly damaging	Het
Gtf2ird1	A	G	5: 134,362,544	F866L	probably damaging	Het
Haao	T	A	17: 83,838,580		probably null	Het
Hcn4	A	T	9: 58,859,570	I805F	unknown	Het
Hemk1	A	T	9: 107,329,448		probably benign	Het
Il12rb1	A	T	8: 70,810,588	Y33F	possibly damaging	Het
Il19	T	A	1: 130,935,946	I103F	probably damaging	Het
Itpr1	A	G	6: 108,410,867	N1522S	probably benign	Het
Klhdc8a	A	G	1: 132,303,105	Y236C	probably damaging	Het
Klhl3	C	T	13: 58,018,806	G404S	probably damaging	Het
Large2	T	C	2: 92,366,634		probably benign	Het
Lgi1	C	A	19: 38,306,250	A490E	probably damaging	Het
Lmbr1	A	G	5: 29,323,809	L112P	probably damaging	Het
Lmo7	T	A	14: 101,887,348		probably null	Het
Lpin1	A	C	12: 16,563,630	I479S	possibly damaging	Het
Lrrc40	T	A	3: 158,066,229		probably benign	Het
Lrrc9	A	G	12: 72,499,692	N1218S	possibly damaging	Het
Map3k9	A	G	12: 81,724,627	V729A	probably benign	Het
Marf1	A	T	16: 14,128,611	Y1215*	probably null	Het
Moap1	T	A	12: 102,742,565	I242L	probably benign	Het
Mpo	A	G	11: 87,796,281	K218E	probably benign	Het
Mpz	C	T	1: 171,158,810	R98C	probably damaging	Het
Neb	T	G	2: 52,201,980	K5024T	probably damaging	Het
Nlrp4b	C	T	7: 10,715,298	T109I	probably benign	Het
Noc3l	T	A	19: 38,792,800		probably null	Het
Nosip	G	A	7: 45,076,678	V220I	probably benign	Het
Nyap1	A	C	5: 137,735,578	S398A	probably damaging	Het
Olfr109	A	G	17: 37,466,823	M206V	possibly damaging	Het
Olfr1240	T	G	2: 89,439,623	I219L	probably damaging	Het
Olfr1278	A	G	2: 111,293,143	N292D	possibly damaging	Het
Osbpl7	T	C	11: 97,056,669		probably benign	Het
Pard3	A	T	8: 127,324,054	Y199F	probably damaging	Het
Pcdha11	G	A	18: 37,011,452	V199I	probably benign	Het
Pcdhga8	A	T	18: 37,726,914	N341I	probably damaging	Het
Pcsk4	A	G	10: 80,325,039	S318P	probably damaging	Het
Phldb1	C	A	9: 44,696,092	R1272L	probably damaging	Het
Phlpp2	A	G	8: 109,877,010	T103A	probably damaging	Het
Pibf1	T	A	14: 99,186,501	Y503*	probably null	Het
Pkn1	A	T	8: 83,684,227		probably null	Het
Ptprf	A	G	4: 118,217,197		probably benign	Het
Rbm19	C	A	5: 120,132,833		probably benign	Het
Rcan1	T	C	16: 92,465,906	D5G	possibly damaging	Het
Recql5	A	T	11: 115,928,212	L176Q	probably damaging	Het
Rev3l	T	A	10: 39,838,459	L2393Q	probably damaging	Het
Rp1	C	A	1: 4,352,316	K180N	probably damaging	Het
Rp1	T	A	1: 4,352,317	K180M	probably damaging	Het
Sdk1	T	C	5: 142,161,776	V1461A	probably benign	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Skint10	A	T	4: 112,746,633	V119D	possibly damaging	Het
Sncaip	T	C	18: 52,869,225	S273P	probably benign	Het
Sp1	T	G	15: 102,430,974	I449S	probably damaging	Het
Spats2	T	C	15: 99,174,420	L78P	probably damaging	Het
Spert	C	T	14: 75,593,038	E8K	probably damaging	Het
Stambp	T	A	6: 83,556,366	N305I	probably benign	Het
Stim2	A	T	5: 54,118,546	S688C	probably damaging	Het
Sytl3	A	G	17: 6,736,581	N355S	probably damaging	Het
Taf4b	C	T	18: 14,804,578	A236V	probably null	Het
Tnfaip6	A	G	2: 52,051,074		probably null	Het
Trpc2	T	A	7: 102,083,969	S416T	probably benign	Het
Ttn	T	C	2: 76,738,866	T27228A	probably damaging	Het
Uhrf1bp1l	A	T	10: 89,779,963	N156I	probably damaging	Het
Ush2a	T	A	1: 188,537,720	D1721E	probably benign	Het
Usp47	T	A	7: 112,082,552	H523Q	probably damaging	Het
Vmn1r8	A	T	6: 57,036,353	I130F	probably benign	Het
Vps13b	A	G	15: 35,456,654	S749G	probably benign	Het
Xrcc5	C	A	1: 72,326,265	T283K	possibly damaging	Het
Ydjc	A	G	16: 17,148,138		probably benign	Het

Other mutations in Sdk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00972:Sdk2	APN	11	113854384	missense	possibly damaging	0.86
IGL01063:Sdk2	APN	11	113830842	missense	probably damaging	1.00
IGL01291:Sdk2	APN	11	113843080	missense	probably benign
IGL01316:Sdk2	APN	11	113867965	missense	probably benign	0.09
IGL01614:Sdk2	APN	11	113793858	missense	probably damaging	1.00
IGL01998:Sdk2	APN	11	113838532	missense	probably damaging	0.98
IGL02014:Sdk2	APN	11	113838494	missense	probably damaging	1.00
IGL02095:Sdk2	APN	11	113834830	missense	probably damaging	1.00
IGL02115:Sdk2	APN	11	113834813	splice site	probably benign
IGL02543:Sdk2	APN	11	113868921	missense	possibly damaging	0.90
IGL02976:Sdk2	APN	11	113851842	missense	probably damaging	1.00
IGL03001:Sdk2	APN	11	113821626	missense	probably benign	0.00
IGL03122:Sdk2	APN	11	113842068	missense	probably damaging	1.00
IGL03183:Sdk2	APN	11	113850984	missense	probably benign	0.19
IGL03222:Sdk2	APN	11	113838431	missense	probably benign	0.01
IGL03310:Sdk2	APN	11	113793325	missense	possibly damaging	0.77
Curtailed	UTSW	11	113851800	missense	probably damaging	1.00
Trimmed	UTSW	11	113856696	nonsense	probably null
ANU05:Sdk2	UTSW	11	113843080	missense	probably benign
BB008:Sdk2	UTSW	11	113893441	missense	possibly damaging	0.79
BB018:Sdk2	UTSW	11	113893441	missense	possibly damaging	0.79
R0008:Sdk2	UTSW	11	113856755	missense	probably damaging	1.00
R0008:Sdk2	UTSW	11	113856755	missense	probably damaging	1.00
R0088:Sdk2	UTSW	11	113827086	missense	possibly damaging	0.74
R0096:Sdk2	UTSW	11	113903144	splice site	probably benign
R0386:Sdk2	UTSW	11	113893464	missense	probably damaging	0.96
R0396:Sdk2	UTSW	11	113829967	missense	probably benign	0.04
R0409:Sdk2	UTSW	11	113850891	splice site	probably benign
R0416:Sdk2	UTSW	11	113803203	missense	probably damaging	1.00
R0456:Sdk2	UTSW	11	113791466	missense	possibly damaging	0.93
R0544:Sdk2	UTSW	11	113781010	missense	probably damaging	1.00
R0691:Sdk2	UTSW	11	113794920	splice site	probably null
R0711:Sdk2	UTSW	11	113903144	splice site	probably benign
R0717:Sdk2	UTSW	11	113832326	missense	probably damaging	1.00
R0780:Sdk2	UTSW	11	113893508	missense	probably benign	0.07
R0831:Sdk2	UTSW	11	113832258	missense	probably damaging	0.96
R0853:Sdk2	UTSW	11	113821415	missense	probably benign	0.00
R0865:Sdk2	UTSW	11	113850922	missense	probably benign	0.12
R0930:Sdk2	UTSW	11	113838445	missense	probably benign	0.01
R0964:Sdk2	UTSW	11	113806417	splice site	probably benign
R1051:Sdk2	UTSW	11	113838646	synonymous	silent
R1052:Sdk2	UTSW	11	113838646	synonymous	silent
R1054:Sdk2	UTSW	11	113838646	synonymous	silent
R1055:Sdk2	UTSW	11	113838646	synonymous	silent
R1077:Sdk2	UTSW	11	113838646	synonymous	silent
R1079:Sdk2	UTSW	11	113838646	synonymous	silent
R1115:Sdk2	UTSW	11	113838646	synonymous	silent
R1186:Sdk2	UTSW	11	113838646	synonymous	silent
R1187:Sdk2	UTSW	11	113838646	synonymous	silent
R1337:Sdk2	UTSW	11	113832331	missense	possibly damaging	0.79
R1430:Sdk2	UTSW	11	113838646	synonymous	silent
R1433:Sdk2	UTSW	11	113795045	missense	probably damaging	0.99
R1464:Sdk2	UTSW	11	113830080	missense	possibly damaging	0.86
R1464:Sdk2	UTSW	11	113830080	missense	possibly damaging	0.86
R1497:Sdk2	UTSW	11	113893575	splice site	probably benign
R1514:Sdk2	UTSW	11	113838646	synonymous	silent
R1529:Sdk2	UTSW	11	113838646	synonymous	silent
R1596:Sdk2	UTSW	11	113838609	splice site	probably benign
R1680:Sdk2	UTSW	11	113791436	missense	possibly damaging	0.47
R1680:Sdk2	UTSW	11	113838646	synonymous	silent
R1770:Sdk2	UTSW	11	113793741	missense	probably benign	0.05
R1858:Sdk2	UTSW	11	113838646	synonymous	silent
R1866:Sdk2	UTSW	11	113838646	synonymous	silent
R1874:Sdk2	UTSW	11	113834956	missense	probably benign	0.00
R1899:Sdk2	UTSW	11	113838646	synonymous	silent
R1905:Sdk2	UTSW	11	113838646	synonymous	silent
R1907:Sdk2	UTSW	11	113838646	synonymous	silent
R1913:Sdk2	UTSW	11	113856726	missense	possibly damaging	0.77
R1964:Sdk2	UTSW	11	113781017	nonsense	probably null
R2055:Sdk2	UTSW	11	113850954	missense	probably damaging	1.00
R2059:Sdk2	UTSW	11	113854332	missense	probably damaging	1.00
R2093:Sdk2	UTSW	11	113943122	missense	probably damaging	1.00
R2256:Sdk2	UTSW	11	113830794	missense	probably benign	0.44
R3720:Sdk2	UTSW	11	113800244	missense	probably damaging	1.00
R3795:Sdk2	UTSW	11	113856696	nonsense	probably null
R4037:Sdk2	UTSW	11	113795055	missense	probably damaging	1.00
R4171:Sdk2	UTSW	11	113866989	splice site	probably null
R4717:Sdk2	UTSW	11	113854369	missense	probably damaging	0.96
R4758:Sdk2	UTSW	11	113827054	missense	possibly damaging	0.87
R4924:Sdk2	UTSW	11	113857758	missense	probably damaging	1.00
R5015:Sdk2	UTSW	11	113793761	missense	probably damaging	1.00
R5171:Sdk2	UTSW	11	113850982	missense	probably benign	0.01
R5239:Sdk2	UTSW	11	113868033	missense	probably damaging	1.00
R5243:Sdk2	UTSW	11	113825086	missense	possibly damaging	0.76
R5279:Sdk2	UTSW	11	113867031	missense	probably benign	0.31
R5535:Sdk2	UTSW	11	113943158	missense	possibly damaging	0.80
R5634:Sdk2	UTSW	11	113851714	missense	probably damaging	1.00
R5637:Sdk2	UTSW	11	113833179	missense	probably damaging	1.00
R5726:Sdk2	UTSW	11	113851800	missense	probably damaging	1.00
R5793:Sdk2	UTSW	11	113868952	missense	possibly damaging	0.46
R5798:Sdk2	UTSW	11	113827116	missense	probably damaging	1.00
R5834:Sdk2	UTSW	11	113854273	missense	probably damaging	1.00
R5863:Sdk2	UTSW	11	113834984	missense	probably damaging	0.98
R5869:Sdk2	UTSW	11	113851882	missense	probably damaging	0.96
R5875:Sdk2	UTSW	11	113830059	missense	probably benign	0.00
R5953:Sdk2	UTSW	11	113793744	missense	probably damaging	1.00
R5991:Sdk2	UTSW	11	113943254	missense	probably damaging	0.97
R6018:Sdk2	UTSW	11	113830063	missense	probably benign	0.00
R6116:Sdk2	UTSW	11	113854364	missense	probably damaging	0.99
R6328:Sdk2	UTSW	11	113793755	missense	probably damaging	1.00
R6348:Sdk2	UTSW	11	113893508	missense	probably benign	0.07
R6383:Sdk2	UTSW	11	113832265	missense	probably damaging	1.00
R6824:Sdk2	UTSW	11	113867934	missense	probably benign	0.43
R6835:Sdk2	UTSW	11	113830048	missense	probably damaging	0.98
R6853:Sdk2	UTSW	11	113780929	missense	probably damaging	0.99
R6912:Sdk2	UTSW	11	113903120	missense	probably benign	0.03
R7000:Sdk2	UTSW	11	113803169	missense	probably damaging	1.00
R7099:Sdk2	UTSW	11	113834905	missense	probably damaging	0.98
R7102:Sdk2	UTSW	11	113842690	nonsense	probably null
R7177:Sdk2	UTSW	11	113829969	missense	possibly damaging	0.91
R7381:Sdk2	UTSW	11	113838489	missense	probably damaging	0.98
R7412:Sdk2	UTSW	11	113868083	splice site	probably null
R7504:Sdk2	UTSW	11	113867967	missense	possibly damaging	0.50
R7552:Sdk2	UTSW	11	113873213	missense	possibly damaging	0.63
R7604:Sdk2	UTSW	11	113829969	missense	possibly damaging	0.91
R7647:Sdk2	UTSW	11	113793737	missense	probably damaging	1.00
R7897:Sdk2	UTSW	11	113873201	missense	possibly damaging	0.50
R7931:Sdk2	UTSW	11	113893441	missense	possibly damaging	0.79
R7998:Sdk2	UTSW	11	113859938	missense	probably benign	0.18
R8052:Sdk2	UTSW	11	113854351	missense	probably damaging	1.00
R8053:Sdk2	UTSW	11	113854351	missense	probably damaging	1.00
R8084:Sdk2	UTSW	11	113827089	missense	possibly damaging	0.67
R8136:Sdk2	UTSW	11	113851713	missense	probably damaging	1.00
R8151:Sdk2	UTSW	11	113872857	missense	possibly damaging	0.84
R8394:Sdk2	UTSW	11	113838716	missense	probably benign
R8715:Sdk2	UTSW	11	113780902	missense	probably damaging	1.00
R8774:Sdk2	UTSW	11	113839343	missense	probably damaging	1.00
R8774-TAIL:Sdk2	UTSW	11	113839343	missense	probably damaging	1.00
R8804:Sdk2	UTSW	11	113873152	nonsense	probably null
R9136:Sdk2	UTSW	11	113806377	missense	probably damaging	1.00
R9147:Sdk2	UTSW	11	113823400	missense	probably benign	0.18
R9300:Sdk2	UTSW	11	113825030	missense	possibly damaging	0.63
R9354:Sdk2	UTSW	11	113834931	missense	probably benign	0.00
R9450:Sdk2	UTSW	11	113806279	missense	probably benign
R9462:Sdk2	UTSW	11	113869918	missense	possibly damaging	0.56
R9616:Sdk2	UTSW	11	113800235	missense	probably benign	0.05
R9678:Sdk2	UTSW	11	113794963	nonsense	probably null
RF002:Sdk2	UTSW	11	113885252	missense	probably benign	0.00
V1662:Sdk2	UTSW	11	113834908	missense	probably damaging	1.00
Z1176:Sdk2	UTSW	11	113839322	missense	probably benign	0.41
Z1176:Sdk2	UTSW	11	113851836	missense	probably damaging	0.97
Z1177:Sdk2	UTSW	11	113838659	missense	probably damaging	0.99
Z1177:Sdk2	UTSW	11	113839320	missense	probably damaging	1.00
Z1177:Sdk2	UTSW	11	113859956	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGTTCAACCCACCTCAGAATGG -3'
(R):5'- GTGAGTTTGAGTCCCAGATACAG -3'

Sequencing Primer
(F):5'- TGGAAATATTCTACAATGCCACAG -3'
(R):5'- GTTTGAGTCCCAGATACAGGATCC -3'

Posted On

2016-03-01