Incidental Mutation 'R4857:Dnah5'
ID 374096
Institutional Source Beutler Lab
Gene Symbol Dnah5
Ensembl Gene ENSMUSG00000022262
Gene Name dynein, axonemal, heavy chain 5
Synonyms Dnahc5, b2b3491Clo, b2b1154Clo, b2b1134Clo, b2b1565Clo, b2b1537Clo, Mdnah5
MMRRC Submission 042468-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.791) question?
Stock # R4857 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 28203898-28472198 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 28345953 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 2431 (D2431G)
Ref Sequence ENSEMBL: ENSMUSP00000069751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067048]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000067048
AA Change: D2431G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000069751
Gene: ENSMUSG00000022262
AA Change: D2431G

DomainStartEndE-ValueType
Pfam:DHC_N1 247 802 2.3e-163 PFAM
low complexity region 1077 1088 N/A INTRINSIC
low complexity region 1113 1128 N/A INTRINSIC
Pfam:DHC_N2 1399 1807 2.3e-134 PFAM
AAA 1972 2108 2e-3 SMART
AAA 2251 2424 4.3e-3 SMART
AAA 2579 2777 2.2e-3 SMART
low complexity region 2874 2889 N/A INTRINSIC
Pfam:AAA_8 2914 3186 3.2e-70 PFAM
Pfam:MT 3198 3546 1e-44 PFAM
Pfam:AAA_9 3567 3792 1.4e-86 PFAM
low complexity region 3889 3899 N/A INTRINSIC
Pfam:Dynein_heavy 3930 4618 4.4e-246 PFAM
Meta Mutation Damage Score 0.1850 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.3%
Validation Efficiency 97% (115/119)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dynein protein, which is part of a microtubule-associated motor protein complex consisting of heavy, light, and intermediate chains. This protein is an axonemal heavy chain dynein. It functions as a force-generating protein with ATPase activity, whereby the release of ADP is thought to produce the force-producing power stroke. Mutations in this gene cause primary ciliary dyskinesia type 3, as well as Kartagener syndrome, which are both diseases due to ciliary defects. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a disruption in this gene display postnatal lethality, hydrocephalus, respiratory infections, situs inversus and ciliary immotility. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(2) Gene trapped(1) Transgenic(1) Chemically induced(7)

Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548G14Rik C T 15: 46,488,927 (GRCm39) noncoding transcript Het
Aasdh A T 5: 77,035,131 (GRCm39) F428L probably benign Het
Abca13 A G 11: 9,244,143 (GRCm39) N2002S probably benign Het
Acot7 T G 4: 152,322,211 (GRCm39) F248V possibly damaging Het
Acsf2 A G 11: 94,460,164 (GRCm39) I396T probably benign Het
Agbl1 A G 7: 76,069,583 (GRCm39) N372D probably benign Het
Ahctf1 A T 1: 179,626,922 (GRCm39) probably benign Het
Akap11 T C 14: 78,736,300 (GRCm39) D1830G Het
Bcl7b A G 5: 135,202,033 (GRCm39) *59W probably null Het
Bdh1 A G 16: 31,266,366 (GRCm39) probably null Het
Bin3 A G 14: 70,366,344 (GRCm39) N69S probably benign Het
Bltp3b A T 10: 89,615,825 (GRCm39) N156I probably damaging Het
Bsdc1 T C 4: 129,365,685 (GRCm39) probably benign Het
Cacna1i T C 15: 80,253,863 (GRCm39) V700A probably damaging Het
Calcr T C 6: 3,708,511 (GRCm39) N225S probably benign Het
Cby2 C T 14: 75,830,478 (GRCm39) E8K probably damaging Het
Cdh23 A G 10: 60,227,563 (GRCm39) S1173P probably damaging Het
Cftr C T 6: 18,320,974 (GRCm39) T1428M possibly damaging Het
Chd1l T C 3: 97,479,975 (GRCm39) K591E probably benign Het
Chrd C T 16: 20,557,508 (GRCm39) P709L possibly damaging Het
Ckap4 T C 10: 84,369,352 (GRCm39) R127G possibly damaging Het
Cnbd2 T C 2: 156,209,485 (GRCm39) F476S probably benign Het
Dclk3 T C 9: 111,297,716 (GRCm39) V420A probably benign Het
Duox1 T A 2: 122,146,212 (GRCm39) I10N probably benign Het
Ece2 T A 16: 20,436,556 (GRCm39) V126D probably damaging Het
Elfn1 T C 5: 139,958,840 (GRCm39) Y615H probably damaging Het
Epha1 T C 6: 42,338,416 (GRCm39) D720G probably benign Het
Fras1 A G 5: 96,926,018 (GRCm39) I3741V probably benign Het
Gm53 A T 11: 96,142,562 (GRCm39) noncoding transcript Het
Grb10 G T 11: 11,901,469 (GRCm39) probably benign Het
Grid2ip A G 5: 143,368,384 (GRCm39) H568R probably damaging Het
Gsap A T 5: 21,492,797 (GRCm39) probably null Het
Gse1 T C 8: 121,299,496 (GRCm39) probably benign Het
Gstm1 T C 3: 107,923,724 (GRCm39) R94G possibly damaging Het
Gtf2ird1 A G 5: 134,391,398 (GRCm39) F866L probably damaging Het
Haao T A 17: 84,146,009 (GRCm39) probably null Het
Hcn4 A T 9: 58,766,853 (GRCm39) I805F unknown Het
Hemk1 A T 9: 107,206,647 (GRCm39) probably benign Het
Il12rb1 A T 8: 71,263,232 (GRCm39) Y33F possibly damaging Het
Il19 T A 1: 130,863,683 (GRCm39) I103F probably damaging Het
Itpr1 A G 6: 108,387,828 (GRCm39) N1522S probably benign Het
Klhdc8a A G 1: 132,230,843 (GRCm39) Y236C probably damaging Het
Klhl3 C T 13: 58,166,620 (GRCm39) G404S probably damaging Het
Large2 T C 2: 92,196,979 (GRCm39) probably benign Het
Lgi1 C A 19: 38,294,698 (GRCm39) A490E probably damaging Het
Lmbr1 A G 5: 29,528,807 (GRCm39) L112P probably damaging Het
Lmo7 T A 14: 102,124,784 (GRCm39) probably null Het
Lpin1 A C 12: 16,613,631 (GRCm39) I479S possibly damaging Het
Lrrc40 T A 3: 157,771,866 (GRCm39) probably benign Het
Lrrc9 A G 12: 72,546,466 (GRCm39) N1218S possibly damaging Het
Map3k9 A G 12: 81,771,401 (GRCm39) V729A probably benign Het
Marf1 A T 16: 13,946,475 (GRCm39) Y1215* probably null Het
Moap1 T A 12: 102,708,824 (GRCm39) I242L probably benign Het
Mpo A G 11: 87,687,107 (GRCm39) K218E probably benign Het
Mpz C T 1: 170,986,379 (GRCm39) R98C probably damaging Het
Neb T G 2: 52,091,992 (GRCm39) K5024T probably damaging Het
Nlrp4b C T 7: 10,449,225 (GRCm39) T109I probably benign Het
Noc3l T A 19: 38,781,244 (GRCm39) probably null Het
Nosip G A 7: 44,726,102 (GRCm39) V220I probably benign Het
Nyap1 A C 5: 137,733,840 (GRCm39) S398A probably damaging Het
Or12d17 A G 17: 37,777,714 (GRCm39) M206V possibly damaging Het
Or4a68 T G 2: 89,269,967 (GRCm39) I219L probably damaging Het
Or4f54 A G 2: 111,123,488 (GRCm39) N292D possibly damaging Het
Osbpl7 T C 11: 96,947,495 (GRCm39) probably benign Het
Pard3 A T 8: 128,050,535 (GRCm39) Y199F probably damaging Het
Pcdha11 G A 18: 37,144,505 (GRCm39) V199I probably benign Het
Pcdhga8 A T 18: 37,859,967 (GRCm39) N341I probably damaging Het
Pcsk4 A G 10: 80,160,873 (GRCm39) S318P probably damaging Het
Phldb1 C A 9: 44,607,389 (GRCm39) R1272L probably damaging Het
Phlpp2 A G 8: 110,603,642 (GRCm39) T103A probably damaging Het
Pibf1 T A 14: 99,423,937 (GRCm39) Y503* probably null Het
Pkn1 A T 8: 84,410,856 (GRCm39) probably null Het
Pramel22 A T 4: 143,383,158 (GRCm39) N20K possibly damaging Het
Ptprf A G 4: 118,074,394 (GRCm39) probably benign Het
Rbm19 C A 5: 120,270,898 (GRCm39) probably benign Het
Rcan1 T C 16: 92,262,794 (GRCm39) D5G possibly damaging Het
Recql5 A T 11: 115,819,038 (GRCm39) L176Q probably damaging Het
Rev3l T A 10: 39,714,455 (GRCm39) L2393Q probably damaging Het
Rp1 C A 1: 4,422,539 (GRCm39) K180N probably damaging Het
Rp1 T A 1: 4,422,540 (GRCm39) K180M probably damaging Het
Sdk1 T C 5: 142,147,531 (GRCm39) V1461A probably benign Het
Sdk2 A T 11: 113,712,208 (GRCm39) L1653* probably null Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Skint10 A T 4: 112,603,830 (GRCm39) V119D possibly damaging Het
Sncaip T C 18: 53,002,297 (GRCm39) S273P probably benign Het
Sp1 T G 15: 102,339,409 (GRCm39) I449S probably damaging Het
Spata31h1 T C 10: 82,119,682 (GRCm39) T4443A possibly damaging Het
Spats2 T C 15: 99,072,301 (GRCm39) L78P probably damaging Het
Stambp T A 6: 83,533,348 (GRCm39) N305I probably benign Het
Stim2 A T 5: 54,275,888 (GRCm39) S688C probably damaging Het
Sytl3 A G 17: 7,003,980 (GRCm39) N355S probably damaging Het
Taf4b C T 18: 14,937,635 (GRCm39) A236V probably null Het
Tnfaip6 A G 2: 51,941,086 (GRCm39) probably null Het
Trpc2 T A 7: 101,733,176 (GRCm39) S416T probably benign Het
Ttn T C 2: 76,569,210 (GRCm39) T27228A probably damaging Het
Ush2a T A 1: 188,269,917 (GRCm39) D1721E probably benign Het
Usp47 T A 7: 111,681,759 (GRCm39) H523Q probably damaging Het
Vmn1r8 A T 6: 57,013,338 (GRCm39) I130F probably benign Het
Vps13b A G 15: 35,456,800 (GRCm39) S749G probably benign Het
Xrcc5 C A 1: 72,365,424 (GRCm39) T283K possibly damaging Het
Ydjc A G 16: 16,966,002 (GRCm39) probably benign Het
Other mutations in Dnah5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Dnah5 APN 15 28,272,488 (GRCm39) missense probably benign
IGL00331:Dnah5 APN 15 28,421,766 (GRCm39) missense probably damaging 1.00
IGL00519:Dnah5 APN 15 28,444,364 (GRCm39) missense probably benign 0.10
IGL00537:Dnah5 APN 15 28,458,848 (GRCm39) critical splice donor site probably null
IGL01102:Dnah5 APN 15 28,410,149 (GRCm39) critical splice donor site probably null
IGL01126:Dnah5 APN 15 28,302,545 (GRCm39) missense possibly damaging 0.85
IGL01154:Dnah5 APN 15 28,458,802 (GRCm39) missense possibly damaging 0.75
IGL01349:Dnah5 APN 15 28,295,059 (GRCm39) splice site probably benign
IGL01353:Dnah5 APN 15 28,233,418 (GRCm39) missense probably benign 0.00
IGL01372:Dnah5 APN 15 28,230,636 (GRCm39) missense probably benign 0.00
IGL01390:Dnah5 APN 15 28,411,686 (GRCm39) missense probably benign 0.00
IGL01446:Dnah5 APN 15 28,326,815 (GRCm39) missense probably damaging 1.00
IGL01472:Dnah5 APN 15 28,331,872 (GRCm39) missense probably damaging 1.00
IGL01485:Dnah5 APN 15 28,331,872 (GRCm39) missense probably damaging 1.00
IGL01568:Dnah5 APN 15 28,229,798 (GRCm39) missense probably benign 0.01
IGL01592:Dnah5 APN 15 28,236,783 (GRCm39) missense probably benign 0.01
IGL01594:Dnah5 APN 15 28,311,480 (GRCm39) missense possibly damaging 0.87
IGL01677:Dnah5 APN 15 28,367,928 (GRCm39) missense probably damaging 1.00
IGL01845:Dnah5 APN 15 28,449,315 (GRCm39) missense probably benign 0.06
IGL01904:Dnah5 APN 15 28,307,510 (GRCm39) missense probably benign 0.09
IGL01913:Dnah5 APN 15 28,313,899 (GRCm39) missense possibly damaging 0.50
IGL01950:Dnah5 APN 15 28,290,435 (GRCm39) missense probably null 1.00
IGL01963:Dnah5 APN 15 28,370,682 (GRCm39) missense probably benign 0.12
IGL02008:Dnah5 APN 15 28,343,698 (GRCm39) missense probably damaging 0.98
IGL02088:Dnah5 APN 15 28,459,264 (GRCm39) critical splice acceptor site probably null
IGL02090:Dnah5 APN 15 28,240,187 (GRCm39) splice site probably benign
IGL02114:Dnah5 APN 15 28,397,270 (GRCm39) missense probably damaging 0.97
IGL02135:Dnah5 APN 15 28,248,031 (GRCm39) missense possibly damaging 0.50
IGL02232:Dnah5 APN 15 28,299,386 (GRCm39) missense probably damaging 1.00
IGL02386:Dnah5 APN 15 28,340,527 (GRCm39) missense probably damaging 1.00
IGL02475:Dnah5 APN 15 28,219,296 (GRCm39) missense probably benign 0.09
IGL02626:Dnah5 APN 15 28,307,422 (GRCm39) missense possibly damaging 0.94
IGL02650:Dnah5 APN 15 28,289,193 (GRCm39) splice site probably benign
IGL02651:Dnah5 APN 15 28,350,768 (GRCm39) missense probably benign 0.05
IGL02652:Dnah5 APN 15 28,366,333 (GRCm39) missense probably damaging 0.99
IGL02670:Dnah5 APN 15 28,409,442 (GRCm39) missense probably damaging 1.00
IGL02697:Dnah5 APN 15 28,445,289 (GRCm39) missense probably benign 0.00
IGL02721:Dnah5 APN 15 28,234,389 (GRCm39) critical splice acceptor site probably null
IGL02858:Dnah5 APN 15 28,453,358 (GRCm39) missense possibly damaging 0.65
IGL02859:Dnah5 APN 15 28,383,771 (GRCm39) missense probably benign 0.01
IGL02945:Dnah5 APN 15 28,270,572 (GRCm39) missense probably benign 0.00
IGL02949:Dnah5 APN 15 28,272,331 (GRCm39) missense probably benign 0.32
IGL02971:Dnah5 APN 15 28,384,607 (GRCm39) missense probably damaging 1.00
IGL03017:Dnah5 APN 15 28,340,471 (GRCm39) missense possibly damaging 0.93
IGL03177:Dnah5 APN 15 28,295,545 (GRCm39) missense probably damaging 0.97
IGL03212:Dnah5 APN 15 28,290,309 (GRCm39) missense probably benign 0.08
IGL03224:Dnah5 APN 15 28,459,300 (GRCm39) missense probably damaging 1.00
IGL03231:Dnah5 APN 15 28,311,294 (GRCm39) missense probably damaging 1.00
IGL03273:Dnah5 APN 15 28,458,795 (GRCm39) missense probably damaging 0.98
IGL03294:Dnah5 APN 15 28,233,441 (GRCm39) critical splice donor site probably null
IGL03331:Dnah5 APN 15 28,420,086 (GRCm39) missense probably damaging 1.00
IGL03337:Dnah5 APN 15 28,290,287 (GRCm39) missense probably benign 0.10
IGL03367:Dnah5 APN 15 28,234,473 (GRCm39) missense possibly damaging 0.95
Firtel UTSW 15 28,448,513 (GRCm39) missense possibly damaging 0.95
lowbar UTSW 15 28,311,279 (GRCm39) splice site probably null
notherone UTSW 15 28,340,552 (GRCm39) missense probably benign 0.13
scheffler UTSW 15 28,438,237 (GRCm39) splice site probably benign
IGL02837:Dnah5 UTSW 15 28,269,546 (GRCm39) missense probably benign
P0008:Dnah5 UTSW 15 28,302,533 (GRCm39) missense probably damaging 1.00
P0014:Dnah5 UTSW 15 28,403,619 (GRCm39) missense probably damaging 1.00
PIT4687001:Dnah5 UTSW 15 28,383,723 (GRCm39) missense probably damaging 0.98
R0030:Dnah5 UTSW 15 28,451,663 (GRCm39) missense probably benign 0.34
R0087:Dnah5 UTSW 15 28,350,759 (GRCm39) missense probably damaging 1.00
R0099:Dnah5 UTSW 15 28,240,080 (GRCm39) missense probably damaging 1.00
R0102:Dnah5 UTSW 15 28,245,897 (GRCm39) splice site probably benign
R0102:Dnah5 UTSW 15 28,245,897 (GRCm39) splice site probably benign
R0104:Dnah5 UTSW 15 28,453,499 (GRCm39) missense possibly damaging 0.88
R0112:Dnah5 UTSW 15 28,263,825 (GRCm39) missense probably benign 0.00
R0122:Dnah5 UTSW 15 28,378,509 (GRCm39) missense probably damaging 1.00
R0126:Dnah5 UTSW 15 28,246,465 (GRCm39) missense probably benign 0.00
R0127:Dnah5 UTSW 15 28,295,071 (GRCm39) missense probably damaging 1.00
R0233:Dnah5 UTSW 15 28,333,216 (GRCm39) missense probably damaging 1.00
R0310:Dnah5 UTSW 15 28,299,256 (GRCm39) missense probably benign 0.19
R0386:Dnah5 UTSW 15 28,383,727 (GRCm39) missense probably damaging 1.00
R0421:Dnah5 UTSW 15 28,229,687 (GRCm39) missense possibly damaging 0.79
R0481:Dnah5 UTSW 15 28,383,745 (GRCm39) missense probably benign 0.31
R0514:Dnah5 UTSW 15 28,366,467 (GRCm39) missense probably damaging 1.00
R0609:Dnah5 UTSW 15 28,327,925 (GRCm39) missense probably benign
R0720:Dnah5 UTSW 15 28,314,007 (GRCm39) missense probably null 0.98
R0731:Dnah5 UTSW 15 28,311,289 (GRCm39) missense possibly damaging 0.78
R0747:Dnah5 UTSW 15 28,444,333 (GRCm39) missense possibly damaging 0.64
R0747:Dnah5 UTSW 15 28,444,332 (GRCm39) missense probably damaging 0.99
R0766:Dnah5 UTSW 15 28,448,633 (GRCm39) missense probably null 0.89
R0849:Dnah5 UTSW 15 28,263,745 (GRCm39) missense probably damaging 0.96
R1034:Dnah5 UTSW 15 28,302,617 (GRCm39) missense probably damaging 1.00
R1084:Dnah5 UTSW 15 28,343,598 (GRCm39) missense probably benign 0.01
R1148:Dnah5 UTSW 15 28,421,836 (GRCm39) missense probably damaging 1.00
R1148:Dnah5 UTSW 15 28,421,836 (GRCm39) missense probably damaging 1.00
R1200:Dnah5 UTSW 15 28,246,403 (GRCm39) missense possibly damaging 0.88
R1208:Dnah5 UTSW 15 28,327,877 (GRCm39) missense probably damaging 1.00
R1208:Dnah5 UTSW 15 28,327,877 (GRCm39) missense probably damaging 1.00
R1269:Dnah5 UTSW 15 28,238,657 (GRCm39) missense probably damaging 1.00
R1373:Dnah5 UTSW 15 28,314,064 (GRCm39) splice site probably benign
R1401:Dnah5 UTSW 15 28,402,059 (GRCm39) missense probably damaging 1.00
R1413:Dnah5 UTSW 15 28,370,555 (GRCm39) missense probably benign
R1430:Dnah5 UTSW 15 28,346,003 (GRCm39) missense probably benign 0.37
R1457:Dnah5 UTSW 15 28,403,688 (GRCm39) critical splice donor site probably null
R1468:Dnah5 UTSW 15 28,230,609 (GRCm39) nonsense probably null
R1468:Dnah5 UTSW 15 28,230,609 (GRCm39) nonsense probably null
R1560:Dnah5 UTSW 15 28,420,149 (GRCm39) missense probably damaging 1.00
R1568:Dnah5 UTSW 15 28,409,323 (GRCm39) missense probably damaging 0.98
R1574:Dnah5 UTSW 15 28,252,569 (GRCm39) missense probably benign 0.00
R1574:Dnah5 UTSW 15 28,252,569 (GRCm39) missense probably benign 0.00
R1603:Dnah5 UTSW 15 28,449,326 (GRCm39) missense probably benign 0.09
R1603:Dnah5 UTSW 15 28,295,131 (GRCm39) splice site probably benign
R1673:Dnah5 UTSW 15 28,290,294 (GRCm39) missense probably benign
R1755:Dnah5 UTSW 15 28,326,782 (GRCm39) missense probably damaging 0.99
R1785:Dnah5 UTSW 15 28,313,932 (GRCm39) missense probably damaging 1.00
R1786:Dnah5 UTSW 15 28,313,932 (GRCm39) missense probably damaging 1.00
R1789:Dnah5 UTSW 15 28,270,572 (GRCm39) missense probably benign 0.00
R1817:Dnah5 UTSW 15 28,246,546 (GRCm39) nonsense probably null
R1819:Dnah5 UTSW 15 28,246,546 (GRCm39) nonsense probably null
R1834:Dnah5 UTSW 15 28,409,270 (GRCm39) missense probably benign 0.00
R1855:Dnah5 UTSW 15 28,411,815 (GRCm39) missense possibly damaging 0.88
R1870:Dnah5 UTSW 15 28,331,859 (GRCm39) nonsense probably null
R1871:Dnah5 UTSW 15 28,331,859 (GRCm39) nonsense probably null
R1987:Dnah5 UTSW 15 28,343,737 (GRCm39) missense probably damaging 0.99
R1988:Dnah5 UTSW 15 28,343,737 (GRCm39) missense probably damaging 0.99
R1989:Dnah5 UTSW 15 28,343,737 (GRCm39) missense probably damaging 0.99
R2062:Dnah5 UTSW 15 28,366,416 (GRCm39) missense probably damaging 1.00
R2069:Dnah5 UTSW 15 28,312,534 (GRCm39) splice site probably null
R2121:Dnah5 UTSW 15 28,297,151 (GRCm39) splice site probably benign
R2128:Dnah5 UTSW 15 28,408,467 (GRCm39) missense probably benign 0.00
R2129:Dnah5 UTSW 15 28,408,467 (GRCm39) missense probably benign 0.00
R2151:Dnah5 UTSW 15 28,444,237 (GRCm39) missense probably damaging 1.00
R2159:Dnah5 UTSW 15 28,252,691 (GRCm39) missense probably benign 0.00
R2207:Dnah5 UTSW 15 28,343,817 (GRCm39) missense probably benign 0.11
R2231:Dnah5 UTSW 15 28,408,563 (GRCm39) critical splice donor site probably null
R2232:Dnah5 UTSW 15 28,408,563 (GRCm39) critical splice donor site probably null
R2282:Dnah5 UTSW 15 28,327,448 (GRCm39) missense probably damaging 0.99
R2305:Dnah5 UTSW 15 28,387,913 (GRCm39) missense probably benign 0.25
R2339:Dnah5 UTSW 15 28,314,028 (GRCm39) missense probably benign 0.00
R2437:Dnah5 UTSW 15 28,307,537 (GRCm39) critical splice donor site probably null
R2696:Dnah5 UTSW 15 28,278,722 (GRCm39) missense probably benign 0.00
R3156:Dnah5 UTSW 15 28,438,237 (GRCm39) splice site probably benign
R3431:Dnah5 UTSW 15 28,295,413 (GRCm39) missense probably benign 0.20
R3700:Dnah5 UTSW 15 28,387,937 (GRCm39) missense possibly damaging 0.72
R3724:Dnah5 UTSW 15 28,270,566 (GRCm39) missense probably benign 0.08
R3732:Dnah5 UTSW 15 28,409,268 (GRCm39) missense possibly damaging 0.64
R3872:Dnah5 UTSW 15 28,411,656 (GRCm39) missense possibly damaging 0.50
R4063:Dnah5 UTSW 15 28,421,144 (GRCm39) missense probably damaging 0.98
R4072:Dnah5 UTSW 15 28,340,444 (GRCm39) nonsense probably null
R4075:Dnah5 UTSW 15 28,293,937 (GRCm39) missense probably benign
R4245:Dnah5 UTSW 15 28,219,335 (GRCm39) missense probably benign
R4254:Dnah5 UTSW 15 28,438,248 (GRCm39) missense probably benign 0.07
R4255:Dnah5 UTSW 15 28,438,248 (GRCm39) missense probably benign 0.07
R4392:Dnah5 UTSW 15 28,289,375 (GRCm39) missense probably benign 0.19
R4552:Dnah5 UTSW 15 28,397,300 (GRCm39) missense probably benign 0.19
R4574:Dnah5 UTSW 15 28,367,909 (GRCm39) missense probably benign 0.05
R4577:Dnah5 UTSW 15 28,289,396 (GRCm39) missense probably benign 0.06
R4587:Dnah5 UTSW 15 28,304,745 (GRCm39) missense probably damaging 1.00
R4631:Dnah5 UTSW 15 28,420,140 (GRCm39) missense probably damaging 1.00
R4631:Dnah5 UTSW 15 28,402,099 (GRCm39) missense probably damaging 1.00
R4676:Dnah5 UTSW 15 28,295,406 (GRCm39) missense possibly damaging 0.65
R4707:Dnah5 UTSW 15 28,372,521 (GRCm39) missense probably damaging 0.97
R4754:Dnah5 UTSW 15 28,421,101 (GRCm39) splice site probably null
R4767:Dnah5 UTSW 15 28,270,620 (GRCm39) missense probably benign 0.02
R4883:Dnah5 UTSW 15 28,343,784 (GRCm39) missense probably benign 0.00
R4889:Dnah5 UTSW 15 28,235,938 (GRCm39) missense probably benign 0.01
R4946:Dnah5 UTSW 15 28,388,050 (GRCm39) missense probably damaging 1.00
R4946:Dnah5 UTSW 15 28,326,703 (GRCm39) missense probably damaging 0.96
R4947:Dnah5 UTSW 15 28,272,518 (GRCm39) missense probably benign
R5033:Dnah5 UTSW 15 28,421,824 (GRCm39) missense probably damaging 0.96
R5164:Dnah5 UTSW 15 28,408,438 (GRCm39) missense probably benign 0.00
R5175:Dnah5 UTSW 15 28,448,550 (GRCm39) missense probably damaging 1.00
R5182:Dnah5 UTSW 15 28,311,424 (GRCm39) missense probably damaging 0.99
R5187:Dnah5 UTSW 15 28,272,318 (GRCm39) missense probably benign 0.41
R5272:Dnah5 UTSW 15 28,350,811 (GRCm39) missense probably benign
R5308:Dnah5 UTSW 15 28,229,797 (GRCm39) missense possibly damaging 0.80
R5310:Dnah5 UTSW 15 28,311,474 (GRCm39) missense probably damaging 1.00
R5322:Dnah5 UTSW 15 28,384,390 (GRCm39) missense probably benign 0.41
R5398:Dnah5 UTSW 15 28,293,872 (GRCm39) missense probably benign
R5596:Dnah5 UTSW 15 28,343,754 (GRCm39) missense probably damaging 1.00
R5603:Dnah5 UTSW 15 28,420,078 (GRCm39) missense probably damaging 1.00
R5619:Dnah5 UTSW 15 28,302,581 (GRCm39) missense probably damaging 1.00
R5656:Dnah5 UTSW 15 28,421,210 (GRCm39) missense probably benign 0.03
R5741:Dnah5 UTSW 15 28,246,513 (GRCm39) missense probably benign 0.11
R5754:Dnah5 UTSW 15 28,402,014 (GRCm39) missense probably benign 0.01
R5763:Dnah5 UTSW 15 28,311,298 (GRCm39) missense probably damaging 1.00
R5824:Dnah5 UTSW 15 28,313,967 (GRCm39) missense probably benign 0.00
R5836:Dnah5 UTSW 15 28,383,738 (GRCm39) missense probably damaging 1.00
R5838:Dnah5 UTSW 15 28,290,341 (GRCm39) missense probably benign 0.00
R5864:Dnah5 UTSW 15 28,297,159 (GRCm39) missense possibly damaging 0.83
R5895:Dnah5 UTSW 15 28,234,599 (GRCm39) splice site probably null
R5896:Dnah5 UTSW 15 28,272,206 (GRCm39) missense probably benign
R5899:Dnah5 UTSW 15 28,448,513 (GRCm39) missense possibly damaging 0.95
R5905:Dnah5 UTSW 15 28,387,979 (GRCm39) missense probably damaging 1.00
R5924:Dnah5 UTSW 15 28,307,473 (GRCm39) missense probably benign 0.41
R5927:Dnah5 UTSW 15 28,335,864 (GRCm39) missense probably benign 0.00
R5929:Dnah5 UTSW 15 28,311,354 (GRCm39) missense probably damaging 1.00
R5929:Dnah5 UTSW 15 28,311,353 (GRCm39) missense probably benign 0.01
R5931:Dnah5 UTSW 15 28,453,425 (GRCm39) missense probably damaging 0.99
R5964:Dnah5 UTSW 15 28,458,730 (GRCm39) missense possibly damaging 0.49
R5975:Dnah5 UTSW 15 28,234,428 (GRCm39) missense probably damaging 1.00
R5993:Dnah5 UTSW 15 28,299,372 (GRCm39) missense probably benign 0.09
R6016:Dnah5 UTSW 15 28,328,030 (GRCm39) missense probably damaging 1.00
R6028:Dnah5 UTSW 15 28,387,979 (GRCm39) missense probably damaging 1.00
R6065:Dnah5 UTSW 15 28,230,614 (GRCm39) missense possibly damaging 0.47
R6117:Dnah5 UTSW 15 28,270,566 (GRCm39) missense probably damaging 0.99
R6143:Dnah5 UTSW 15 28,233,377 (GRCm39) missense probably benign 0.05
R6146:Dnah5 UTSW 15 28,459,331 (GRCm39) missense probably benign
R6154:Dnah5 UTSW 15 28,204,177 (GRCm39) missense probably benign 0.15
R6164:Dnah5 UTSW 15 28,378,489 (GRCm39) missense probably benign 0.08
R6266:Dnah5 UTSW 15 28,335,773 (GRCm39) missense possibly damaging 0.67
R6321:Dnah5 UTSW 15 28,372,557 (GRCm39) missense probably damaging 0.99
R6349:Dnah5 UTSW 15 28,238,657 (GRCm39) missense probably damaging 1.00
R6431:Dnah5 UTSW 15 28,349,970 (GRCm39) missense possibly damaging 0.52
R6467:Dnah5 UTSW 15 28,438,329 (GRCm39) missense probably benign 0.10
R6564:Dnah5 UTSW 15 28,367,891 (GRCm39) missense probably benign
R6607:Dnah5 UTSW 15 28,445,346 (GRCm39) missense possibly damaging 0.95
R6619:Dnah5 UTSW 15 28,409,266 (GRCm39) missense probably benign 0.03
R6633:Dnah5 UTSW 15 28,293,933 (GRCm39) missense probably benign 0.27
R6647:Dnah5 UTSW 15 28,403,633 (GRCm39) missense probably benign 0.02
R6782:Dnah5 UTSW 15 28,449,302 (GRCm39) missense possibly damaging 0.89
R6797:Dnah5 UTSW 15 28,233,384 (GRCm39) nonsense probably null
R6797:Dnah5 UTSW 15 28,451,609 (GRCm39) missense probably damaging 1.00
R6831:Dnah5 UTSW 15 28,411,661 (GRCm39) missense possibly damaging 0.88
R6849:Dnah5 UTSW 15 28,278,770 (GRCm39) missense probably benign 0.14
R6871:Dnah5 UTSW 15 28,229,786 (GRCm39) missense probably benign 0.32
R6936:Dnah5 UTSW 15 28,409,414 (GRCm39) missense probably damaging 1.00
R6943:Dnah5 UTSW 15 28,235,866 (GRCm39) missense probably damaging 1.00
R7030:Dnah5 UTSW 15 28,333,208 (GRCm39) missense probably benign 0.00
R7030:Dnah5 UTSW 15 28,238,738 (GRCm39) missense probably benign
R7032:Dnah5 UTSW 15 28,326,796 (GRCm39) missense probably damaging 1.00
R7063:Dnah5 UTSW 15 28,233,394 (GRCm39) missense probably benign 0.00
R7094:Dnah5 UTSW 15 28,453,482 (GRCm39) missense probably damaging 0.98
R7097:Dnah5 UTSW 15 28,453,410 (GRCm39) missense probably benign 0.00
R7126:Dnah5 UTSW 15 28,349,983 (GRCm39) missense probably benign 0.03
R7153:Dnah5 UTSW 15 28,365,668 (GRCm39) splice site probably null
R7209:Dnah5 UTSW 15 28,459,371 (GRCm39) missense possibly damaging 0.71
R7276:Dnah5 UTSW 15 28,367,984 (GRCm39) missense probably damaging 1.00
R7320:Dnah5 UTSW 15 28,270,616 (GRCm39) missense probably null 0.33
R7350:Dnah5 UTSW 15 28,235,965 (GRCm39) critical splice donor site probably null
R7380:Dnah5 UTSW 15 28,370,524 (GRCm39) missense probably damaging 1.00
R7438:Dnah5 UTSW 15 28,347,098 (GRCm39) missense probably damaging 0.99
R7499:Dnah5 UTSW 15 28,302,596 (GRCm39) missense probably damaging 1.00
R7513:Dnah5 UTSW 15 28,370,561 (GRCm39) missense probably benign
R7519:Dnah5 UTSW 15 28,390,629 (GRCm39) missense probably damaging 0.98
R7524:Dnah5 UTSW 15 28,297,212 (GRCm39) missense possibly damaging 0.50
R7556:Dnah5 UTSW 15 28,290,389 (GRCm39) missense probably null 0.43
R7570:Dnah5 UTSW 15 28,347,098 (GRCm39) missense probably damaging 1.00
R7585:Dnah5 UTSW 15 28,402,014 (GRCm39) missense probably benign 0.09
R7642:Dnah5 UTSW 15 28,248,125 (GRCm39) critical splice donor site probably null
R7670:Dnah5 UTSW 15 28,246,378 (GRCm39) splice site probably null
R7763:Dnah5 UTSW 15 28,314,001 (GRCm39) missense probably damaging 1.00
R7821:Dnah5 UTSW 15 28,411,678 (GRCm39) missense possibly damaging 0.89
R7826:Dnah5 UTSW 15 28,367,958 (GRCm39) missense probably damaging 1.00
R7872:Dnah5 UTSW 15 28,245,830 (GRCm39) missense probably damaging 0.99
R7889:Dnah5 UTSW 15 28,448,560 (GRCm39) nonsense probably null
R7919:Dnah5 UTSW 15 28,350,742 (GRCm39) missense probably damaging 1.00
R7920:Dnah5 UTSW 15 28,453,368 (GRCm39) missense probably benign 0.00
R7936:Dnah5 UTSW 15 28,345,983 (GRCm39) missense possibly damaging 0.64
R7996:Dnah5 UTSW 15 28,409,323 (GRCm39) missense probably damaging 0.98
R8063:Dnah5 UTSW 15 28,230,729 (GRCm39) missense probably benign
R8084:Dnah5 UTSW 15 28,388,099 (GRCm39) missense probably damaging 1.00
R8105:Dnah5 UTSW 15 28,372,548 (GRCm39) missense probably benign
R8114:Dnah5 UTSW 15 28,240,122 (GRCm39) missense probably benign 0.01
R8142:Dnah5 UTSW 15 28,384,519 (GRCm39) missense probably benign 0.36
R8153:Dnah5 UTSW 15 28,384,576 (GRCm39) missense probably damaging 1.00
R8161:Dnah5 UTSW 15 28,350,850 (GRCm39) missense possibly damaging 0.79
R8174:Dnah5 UTSW 15 28,311,279 (GRCm39) splice site probably null
R8187:Dnah5 UTSW 15 28,384,355 (GRCm39) missense probably damaging 1.00
R8194:Dnah5 UTSW 15 28,453,414 (GRCm39) missense probably damaging 0.99
R8280:Dnah5 UTSW 15 28,408,538 (GRCm39) missense probably benign 0.01
R8291:Dnah5 UTSW 15 28,263,743 (GRCm39) missense probably benign 0.03
R8324:Dnah5 UTSW 15 28,347,011 (GRCm39) missense probably damaging 1.00
R8347:Dnah5 UTSW 15 28,236,812 (GRCm39) missense possibly damaging 0.90
R8356:Dnah5 UTSW 15 28,444,313 (GRCm39) missense probably benign 0.03
R8356:Dnah5 UTSW 15 28,444,469 (GRCm39) missense probably null 0.02
R8361:Dnah5 UTSW 15 28,331,956 (GRCm39) missense probably damaging 0.98
R8375:Dnah5 UTSW 15 28,327,489 (GRCm39) missense probably benign 0.00
R8474:Dnah5 UTSW 15 28,247,978 (GRCm39) missense probably benign 0.00
R8481:Dnah5 UTSW 15 28,419,941 (GRCm39) missense probably benign 0.00
R8494:Dnah5 UTSW 15 28,345,977 (GRCm39) missense probably benign 0.32
R8495:Dnah5 UTSW 15 28,409,414 (GRCm39) missense probably damaging 0.97
R8519:Dnah5 UTSW 15 28,299,245 (GRCm39) missense probably benign 0.07
R8683:Dnah5 UTSW 15 28,289,367 (GRCm39) missense probably benign 0.00
R8739:Dnah5 UTSW 15 28,346,006 (GRCm39) missense probably benign 0.01
R8752:Dnah5 UTSW 15 28,290,365 (GRCm39) missense probably benign 0.00
R8784:Dnah5 UTSW 15 28,388,097 (GRCm39) missense probably benign 0.16
R8813:Dnah5 UTSW 15 28,229,719 (GRCm39) missense probably damaging 1.00
R8862:Dnah5 UTSW 15 28,459,502 (GRCm39) splice site probably benign
R8873:Dnah5 UTSW 15 28,219,334 (GRCm39) missense probably benign
R8885:Dnah5 UTSW 15 28,327,886 (GRCm39) missense probably damaging 1.00
R8901:Dnah5 UTSW 15 28,365,715 (GRCm39) missense possibly damaging 0.76
R9025:Dnah5 UTSW 15 28,409,412 (GRCm39) missense probably damaging 1.00
R9037:Dnah5 UTSW 15 28,248,104 (GRCm39) missense probably benign 0.05
R9057:Dnah5 UTSW 15 28,391,014 (GRCm39) missense probably damaging 1.00
R9059:Dnah5 UTSW 15 28,245,812 (GRCm39) missense probably benign
R9065:Dnah5 UTSW 15 28,293,936 (GRCm39) missense probably benign 0.09
R9098:Dnah5 UTSW 15 28,420,107 (GRCm39) missense
R9118:Dnah5 UTSW 15 28,401,994 (GRCm39) frame shift probably null
R9149:Dnah5 UTSW 15 28,387,914 (GRCm39) missense probably benign 0.00
R9184:Dnah5 UTSW 15 28,340,552 (GRCm39) missense probably benign 0.13
R9205:Dnah5 UTSW 15 28,448,480 (GRCm39) missense possibly damaging 0.88
R9297:Dnah5 UTSW 15 28,204,054 (GRCm39) start gained probably benign
R9302:Dnah5 UTSW 15 28,240,032 (GRCm39) missense probably benign 0.03
R9310:Dnah5 UTSW 15 28,448,579 (GRCm39) missense probably damaging 1.00
R9318:Dnah5 UTSW 15 28,204,054 (GRCm39) start gained probably benign
R9405:Dnah5 UTSW 15 28,272,306 (GRCm39) missense probably benign
R9424:Dnah5 UTSW 15 28,272,286 (GRCm39) missense probably benign 0.01
R9467:Dnah5 UTSW 15 28,366,293 (GRCm39) missense possibly damaging 0.94
R9469:Dnah5 UTSW 15 28,421,146 (GRCm39) missense probably benign 0.06
R9548:Dnah5 UTSW 15 28,328,025 (GRCm39) missense possibly damaging 0.79
R9564:Dnah5 UTSW 15 28,290,422 (GRCm39) missense probably benign 0.04
R9576:Dnah5 UTSW 15 28,272,286 (GRCm39) missense probably benign 0.01
R9593:Dnah5 UTSW 15 28,236,774 (GRCm39) missense probably benign
R9644:Dnah5 UTSW 15 28,230,650 (GRCm39) missense probably damaging 0.98
R9655:Dnah5 UTSW 15 28,242,900 (GRCm39) missense probably benign
R9657:Dnah5 UTSW 15 28,410,089 (GRCm39) missense probably damaging 1.00
R9704:Dnah5 UTSW 15 28,247,965 (GRCm39) missense probably benign 0.00
R9797:Dnah5 UTSW 15 28,233,316 (GRCm39) missense probably benign 0.34
RF009:Dnah5 UTSW 15 28,204,165 (GRCm39) missense probably benign 0.00
X0011:Dnah5 UTSW 15 28,408,527 (GRCm39) missense probably benign 0.16
X0018:Dnah5 UTSW 15 28,269,500 (GRCm39) missense probably benign 0.00
X0022:Dnah5 UTSW 15 28,270,557 (GRCm39) missense probably benign 0.01
X0023:Dnah5 UTSW 15 28,384,454 (GRCm39) missense probably damaging 0.99
X0028:Dnah5 UTSW 15 28,470,623 (GRCm39) missense probably damaging 1.00
Z1088:Dnah5 UTSW 15 28,366,503 (GRCm39) missense probably null 0.10
Z1088:Dnah5 UTSW 15 28,384,376 (GRCm39) missense probably damaging 1.00
Z1177:Dnah5 UTSW 15 28,295,457 (GRCm39) missense probably damaging 0.98
Z1177:Dnah5 UTSW 15 28,270,549 (GRCm39) missense probably benign 0.00
Z1177:Dnah5 UTSW 15 28,270,500 (GRCm39) missense probably benign 0.32
Z1177:Dnah5 UTSW 15 28,387,909 (GRCm39) missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TGGACCAGCACACGTGAATG -3'
(R):5'- AACCGGTGCTTCTGAAACCTC -3'

Sequencing Primer
(F):5'- CAGGCTTGATGGCATCTTAAGCAC -3'
(R):5'- GTGCTTCTGAAACCTCTCCCAAC -3'
Posted On 2016-03-01