Mutagenetix > Incidental Mutation

Incidental Mutation 'R4857:Vps13b'

374097

Institutional Source

Beutler Lab

Gene Symbol

Vps13b

Ensembl Gene

ENSMUSG00000037646

Gene Name

vacuolar protein sorting 13B

Synonyms

2310042E16Rik, 1810042B05Rik, Coh1, C330002D13Rik

MMRRC Submission

042468-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4857 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

35371160-35931229 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 35456654 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 749 (S749G)

Ref Sequence

ENSEMBL: ENSMUSP00000045490 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048646]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000048646
AA Change: S749G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000045490
Gene: ENSMUSG00000037646
AA Change: S749G

Domain	Start	End	E-Value	Type
Pfam:Chorein_N	2	120	1e-29	PFAM
low complexity region	128	137	N/A	INTRINSIC
low complexity region	143	160	N/A	INTRINSIC
low complexity region	975	984	N/A	INTRINSIC
low complexity region	1007	1018	N/A	INTRINSIC
low complexity region	1876	1883	N/A	INTRINSIC
low complexity region	2042	2054	N/A	INTRINSIC
low complexity region	2414	2423	N/A	INTRINSIC
Pfam:SHR-BD	2601	2700	8.4e-10	PFAM
low complexity region	2954	2964	N/A	INTRINSIC
Pfam:VPS13_C	3539	3706	2.6e-30	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226579

Meta Mutation Damage Score

0.0586

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.3%

Validation Efficiency

97% (115/119)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a potential transmembrane protein that may function in vesicle-mediated transport and sorting of proteins within the cell. This protein may play a role in the development and the function of the eye, hematological system, and central nervous system. Mutations in this gene have been associated with Cohen syndrome. Multiple splice variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930548G14Rik	C	T	15: 46,625,531		noncoding transcript	Het
4932415D10Rik	T	C	10: 82,283,848	T4443A	possibly damaging	Het
Aasdh	A	T	5: 76,887,284	F428L	probably benign	Het
Abca13	A	G	11: 9,294,143	N2002S	probably benign	Het
Acot7	T	G	4: 152,237,754	F248V	possibly damaging	Het
Acsf2	A	G	11: 94,569,338	I396T	probably benign	Het
Agbl1	A	G	7: 76,419,835	N372D	probably benign	Het
Ahctf1	A	T	1: 179,799,357		probably benign	Het
Akap11	T	C	14: 78,498,860	D1830G		Het
Bcl7b	A	G	5: 135,173,179	*59W	probably null	Het
Bdh1	A	G	16: 31,447,548		probably null	Het
Bin3	A	G	14: 70,128,895	N69S	probably benign	Het
Bsdc1	T	C	4: 129,471,892		probably benign	Het
Cacna1i	T	C	15: 80,369,662	V700A	probably damaging	Het
Calcr	T	C	6: 3,708,511	N225S	probably benign	Het
Cdh23	A	G	10: 60,391,784	S1173P	probably damaging	Het
Cftr	C	T	6: 18,320,975	T1428M	possibly damaging	Het
Chd1l	T	C	3: 97,572,659	K591E	probably benign	Het
Chrd	C	T	16: 20,738,758	P709L	possibly damaging	Het
Ckap4	T	C	10: 84,533,488	R127G	possibly damaging	Het
Cnbd2	T	C	2: 156,367,565	F476S	probably benign	Het
Dclk3	T	C	9: 111,468,648	V420A	probably benign	Het
Dnah5	A	G	15: 28,345,807	D2431G	probably benign	Het
Duox1	T	A	2: 122,315,731	I10N	probably benign	Het
Ece2	T	A	16: 20,617,806	V126D	probably damaging	Het
Elfn1	T	C	5: 139,973,085	Y615H	probably damaging	Het
Epha1	T	C	6: 42,361,482	D720G	probably benign	Het
Fras1	A	G	5: 96,778,159	I3741V	probably benign	Het
Gm13088	A	T	4: 143,656,588	N20K	possibly damaging	Het
Gm53	A	T	11: 96,251,736		noncoding transcript	Het
Grb10	G	T	11: 11,951,469		probably benign	Het
Grid2ip	A	G	5: 143,382,629	H568R	probably damaging	Het
Gsap	A	T	5: 21,287,799		probably null	Het
Gse1	T	C	8: 120,572,757		probably benign	Het
Gstm1	T	C	3: 108,016,408	R94G	possibly damaging	Het
Gtf2ird1	A	G	5: 134,362,544	F866L	probably damaging	Het
Haao	T	A	17: 83,838,580		probably null	Het
Hcn4	A	T	9: 58,859,570	I805F	unknown	Het
Hemk1	A	T	9: 107,329,448		probably benign	Het
Il12rb1	A	T	8: 70,810,588	Y33F	possibly damaging	Het
Il19	T	A	1: 130,935,946	I103F	probably damaging	Het
Itpr1	A	G	6: 108,410,867	N1522S	probably benign	Het
Klhdc8a	A	G	1: 132,303,105	Y236C	probably damaging	Het
Klhl3	C	T	13: 58,018,806	G404S	probably damaging	Het
Large2	T	C	2: 92,366,634		probably benign	Het
Lgi1	C	A	19: 38,306,250	A490E	probably damaging	Het
Lmbr1	A	G	5: 29,323,809	L112P	probably damaging	Het
Lmo7	T	A	14: 101,887,348		probably null	Het
Lpin1	A	C	12: 16,563,630	I479S	possibly damaging	Het
Lrrc40	T	A	3: 158,066,229		probably benign	Het
Lrrc9	A	G	12: 72,499,692	N1218S	possibly damaging	Het
Map3k9	A	G	12: 81,724,627	V729A	probably benign	Het
Marf1	A	T	16: 14,128,611	Y1215*	probably null	Het
Moap1	T	A	12: 102,742,565	I242L	probably benign	Het
Mpo	A	G	11: 87,796,281	K218E	probably benign	Het
Mpz	C	T	1: 171,158,810	R98C	probably damaging	Het
Neb	T	G	2: 52,201,980	K5024T	probably damaging	Het
Nlrp4b	C	T	7: 10,715,298	T109I	probably benign	Het
Noc3l	T	A	19: 38,792,800		probably null	Het
Nosip	G	A	7: 45,076,678	V220I	probably benign	Het
Nyap1	A	C	5: 137,735,578	S398A	probably damaging	Het
Olfr109	A	G	17: 37,466,823	M206V	possibly damaging	Het
Olfr1240	T	G	2: 89,439,623	I219L	probably damaging	Het
Olfr1278	A	G	2: 111,293,143	N292D	possibly damaging	Het
Osbpl7	T	C	11: 97,056,669		probably benign	Het
Pard3	A	T	8: 127,324,054	Y199F	probably damaging	Het
Pcdha11	G	A	18: 37,011,452	V199I	probably benign	Het
Pcdhga8	A	T	18: 37,726,914	N341I	probably damaging	Het
Pcsk4	A	G	10: 80,325,039	S318P	probably damaging	Het
Phldb1	C	A	9: 44,696,092	R1272L	probably damaging	Het
Phlpp2	A	G	8: 109,877,010	T103A	probably damaging	Het
Pibf1	T	A	14: 99,186,501	Y503*	probably null	Het
Pkn1	A	T	8: 83,684,227		probably null	Het
Ptprf	A	G	4: 118,217,197		probably benign	Het
Rbm19	C	A	5: 120,132,833		probably benign	Het
Rcan1	T	C	16: 92,465,906	D5G	possibly damaging	Het
Recql5	A	T	11: 115,928,212	L176Q	probably damaging	Het
Rev3l	T	A	10: 39,838,459	L2393Q	probably damaging	Het
Rp1	C	A	1: 4,352,316	K180N	probably damaging	Het
Rp1	T	A	1: 4,352,317	K180M	probably damaging	Het
Sdk1	T	C	5: 142,161,776	V1461A	probably benign	Het
Sdk2	A	T	11: 113,821,382	L1653*	probably null	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Skint10	A	T	4: 112,746,633	V119D	possibly damaging	Het
Sncaip	T	C	18: 52,869,225	S273P	probably benign	Het
Sp1	T	G	15: 102,430,974	I449S	probably damaging	Het
Spats2	T	C	15: 99,174,420	L78P	probably damaging	Het
Spert	C	T	14: 75,593,038	E8K	probably damaging	Het
Stambp	T	A	6: 83,556,366	N305I	probably benign	Het
Stim2	A	T	5: 54,118,546	S688C	probably damaging	Het
Sytl3	A	G	17: 6,736,581	N355S	probably damaging	Het
Taf4b	C	T	18: 14,804,578	A236V	probably null	Het
Tnfaip6	A	G	2: 52,051,074		probably null	Het
Trpc2	T	A	7: 102,083,969	S416T	probably benign	Het
Ttn	T	C	2: 76,738,866	T27228A	probably damaging	Het
Uhrf1bp1l	A	T	10: 89,779,963	N156I	probably damaging	Het
Ush2a	T	A	1: 188,537,720	D1721E	probably benign	Het
Usp47	T	A	7: 112,082,552	H523Q	probably damaging	Het
Vmn1r8	A	T	6: 57,036,353	I130F	probably benign	Het
Xrcc5	C	A	1: 72,326,265	T283K	possibly damaging	Het
Ydjc	A	G	16: 17,148,138		probably benign	Het

Other mutations in Vps13b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Vps13b	APN	15	35926226	missense	possibly damaging	0.52
IGL00513:Vps13b	APN	15	35793884	missense	probably damaging	1.00
IGL00516:Vps13b	APN	15	35640557	missense	probably damaging	1.00
IGL00640:Vps13b	APN	15	35417577	missense	probably benign
IGL00753:Vps13b	APN	15	35372031	missense	probably damaging	0.99
IGL00784:Vps13b	APN	15	35846900	missense	probably damaging	1.00
IGL01138:Vps13b	APN	15	35446770	splice site	probably benign
IGL01349:Vps13b	APN	15	35793945	missense	probably benign	0.00
IGL01403:Vps13b	APN	15	35709479	missense	probably benign	0.00
IGL01535:Vps13b	APN	15	35454957	missense	possibly damaging	0.67
IGL01571:Vps13b	APN	15	35877489	splice site	probably benign
IGL01642:Vps13b	APN	15	35792072	missense	probably benign	0.43
IGL01658:Vps13b	APN	15	35671333	missense	probably damaging	0.99
IGL01759:Vps13b	APN	15	35878789	missense	probably damaging	1.00
IGL01763:Vps13b	APN	15	35709799	missense	possibly damaging	0.72
IGL01906:Vps13b	APN	15	35639847	splice site	probably benign
IGL01982:Vps13b	APN	15	35438904	nonsense	probably null
IGL01997:Vps13b	APN	15	35709224	missense	probably damaging	1.00
IGL02041:Vps13b	APN	15	35423245	missense	probably damaging	0.98
IGL02073:Vps13b	APN	15	35875586	missense	possibly damaging	0.52
IGL02077:Vps13b	APN	15	35910613	missense	possibly damaging	0.68
IGL02141:Vps13b	APN	15	35572081	missense	probably benign	0.09
IGL02146:Vps13b	APN	15	35646333	missense	probably benign	0.36
IGL02197:Vps13b	APN	15	35930056	missense	probably benign	0.02
IGL02311:Vps13b	APN	15	35709514	missense	probably benign	0.08
IGL02466:Vps13b	APN	15	35770741	missense	possibly damaging	0.86
IGL02506:Vps13b	APN	15	35917162	missense	probably damaging	1.00
IGL02550:Vps13b	APN	15	35572096	missense	probably benign
IGL02553:Vps13b	APN	15	35646301	missense	probably benign	0.00
IGL02674:Vps13b	APN	15	35639958	missense	probably benign	0.41
IGL02690:Vps13b	APN	15	35917142	missense	probably damaging	1.00
IGL02731:Vps13b	APN	15	35917128	missense	probably benign	0.00
IGL02739:Vps13b	APN	15	35879900	missense	probably damaging	1.00
IGL02868:Vps13b	APN	15	35884519	missense	probably benign	0.03
IGL03081:Vps13b	APN	15	35875820	missense	probably damaging	0.97
IGL03178:Vps13b	APN	15	35869300	missense	probably damaging	1.00
IGL03343:Vps13b	APN	15	35917170	missense	possibly damaging	0.76
IGL03407:Vps13b	APN	15	35639866	missense	possibly damaging	0.95
IGL03410:Vps13b	APN	15	35910340	missense	probably benign
omlette	UTSW	15	35671400	missense	probably benign	0.13
swiss	UTSW	15	35709673	missense	possibly damaging	0.80
FR4449:Vps13b	UTSW	15	35846957	missense	probably damaging	1.00
FR4548:Vps13b	UTSW	15	35846957	missense	probably damaging	1.00
FR4737:Vps13b	UTSW	15	35846957	missense	probably damaging	1.00
FR4976:Vps13b	UTSW	15	35846957	missense	probably damaging	1.00
LCD18:Vps13b	UTSW	15	35846957	missense	probably damaging	1.00
PIT4531001:Vps13b	UTSW	15	35878825	missense	probably damaging	1.00
PIT4581001:Vps13b	UTSW	15	35534263	missense	probably damaging	1.00
PIT4618001:Vps13b	UTSW	15	35709240	missense	probably damaging	1.00
R0026:Vps13b	UTSW	15	35923301	missense	possibly damaging	0.62
R0026:Vps13b	UTSW	15	35923301	missense	possibly damaging	0.62
R0108:Vps13b	UTSW	15	35572119	missense	probably benign	0.20
R0109:Vps13b	UTSW	15	35572119	missense	probably benign	0.20
R0109:Vps13b	UTSW	15	35572119	missense	probably benign	0.20
R0116:Vps13b	UTSW	15	35423155	missense	probably damaging	0.99
R0123:Vps13b	UTSW	15	35887261	missense	probably benign	0.01
R0124:Vps13b	UTSW	15	35576528	critical splice donor site	probably null
R0134:Vps13b	UTSW	15	35887261	missense	probably benign	0.01
R0137:Vps13b	UTSW	15	35926219	missense	probably benign	0.06
R0195:Vps13b	UTSW	15	35471899	missense	probably benign	0.00
R0225:Vps13b	UTSW	15	35887261	missense	probably benign	0.01
R0320:Vps13b	UTSW	15	35674828	missense	probably damaging	0.98
R0333:Vps13b	UTSW	15	35879803	missense	probably damaging	1.00
R0336:Vps13b	UTSW	15	35455133	nonsense	probably null
R0463:Vps13b	UTSW	15	35597409	missense	probably damaging	0.98
R0466:Vps13b	UTSW	15	35445602	nonsense	probably null
R0472:Vps13b	UTSW	15	35417633	critical splice donor site	probably null
R0523:Vps13b	UTSW	15	35472050	missense	probably benign	0.20
R0602:Vps13b	UTSW	15	35422368	missense	probably damaging	1.00
R0612:Vps13b	UTSW	15	35623657	missense	probably benign	0.12
R0627:Vps13b	UTSW	15	35371999	nonsense	probably null
R0679:Vps13b	UTSW	15	35709703	missense	possibly damaging	0.73
R0742:Vps13b	UTSW	15	35794361	missense	probably benign	0.22
R1053:Vps13b	UTSW	15	35652363	missense	probably damaging	1.00
R1355:Vps13b	UTSW	15	35422454	missense	probably damaging	1.00
R1386:Vps13b	UTSW	15	35923312	missense	probably damaging	0.99
R1403:Vps13b	UTSW	15	35709122	splice site	probably benign
R1453:Vps13b	UTSW	15	35422444	missense	probably damaging	0.97
R1464:Vps13b	UTSW	15	35709484	missense	probably benign	0.14
R1464:Vps13b	UTSW	15	35709484	missense	probably benign	0.14
R1511:Vps13b	UTSW	15	35839975	missense	probably damaging	0.99
R1511:Vps13b	UTSW	15	35841573	missense	probably benign	0.00
R1513:Vps13b	UTSW	15	35438730	nonsense	probably null
R1536:Vps13b	UTSW	15	35875566	missense	probably damaging	0.98
R1537:Vps13b	UTSW	15	35792181	missense	possibly damaging	0.62
R1558:Vps13b	UTSW	15	35534319	missense	probably damaging	1.00
R1601:Vps13b	UTSW	15	35642436	missense	probably benign	0.11
R1653:Vps13b	UTSW	15	35607272	nonsense	probably null
R1695:Vps13b	UTSW	15	35576521	missense	probably benign	0.05
R1760:Vps13b	UTSW	15	35884619	missense	possibly damaging	0.54
R1785:Vps13b	UTSW	15	35879791	missense	probably damaging	1.00
R1786:Vps13b	UTSW	15	35879791	missense	probably damaging	1.00
R1803:Vps13b	UTSW	15	35430205	nonsense	probably null
R1804:Vps13b	UTSW	15	35917137	missense	probably damaging	1.00
R1808:Vps13b	UTSW	15	35792059	missense	probably benign	0.00
R1817:Vps13b	UTSW	15	35910642	missense	possibly damaging	0.86
R1818:Vps13b	UTSW	15	35877577	missense	probably benign	0.00
R1836:Vps13b	UTSW	15	35910232	missense	probably damaging	0.99
R1850:Vps13b	UTSW	15	35674959	splice site	probably benign
R1884:Vps13b	UTSW	15	35430291	splice site	probably benign
R1938:Vps13b	UTSW	15	35709507	missense	probably damaging	1.00
R1955:Vps13b	UTSW	15	35925408	critical splice donor site	probably null
R1956:Vps13b	UTSW	15	35869407	missense	probably damaging	1.00
R1958:Vps13b	UTSW	15	35878689	missense	probably damaging	0.99
R2013:Vps13b	UTSW	15	35607142	missense	probably damaging	0.99
R2014:Vps13b	UTSW	15	35607142	missense	probably damaging	0.99
R2015:Vps13b	UTSW	15	35607142	missense	probably damaging	0.99
R2038:Vps13b	UTSW	15	35884741	missense	probably damaging	1.00
R2058:Vps13b	UTSW	15	35841447	missense	probably damaging	1.00
R2082:Vps13b	UTSW	15	35910746	missense	possibly damaging	0.70
R2087:Vps13b	UTSW	15	35597493	missense	probably damaging	0.99
R2124:Vps13b	UTSW	15	35646080	missense	probably benign	0.08
R2130:Vps13b	UTSW	15	35671400	missense	probably benign	0.13
R2168:Vps13b	UTSW	15	35792188	missense	probably damaging	1.00
R2168:Vps13b	UTSW	15	35792189	missense	probably damaging	1.00
R2171:Vps13b	UTSW	15	35887197	missense	probably benign	0.44
R2221:Vps13b	UTSW	15	35884597	missense	probably benign
R2263:Vps13b	UTSW	15	35646181	missense	probably benign	0.02
R2289:Vps13b	UTSW	15	35572105	missense	probably damaging	1.00
R2316:Vps13b	UTSW	15	35674899	nonsense	probably null
R2351:Vps13b	UTSW	15	35869311	missense	probably damaging	1.00
R2512:Vps13b	UTSW	15	35884555	missense	probably benign	0.35
R3054:Vps13b	UTSW	15	35646361	missense	probably damaging	0.99
R3055:Vps13b	UTSW	15	35646361	missense	probably damaging	0.99
R3196:Vps13b	UTSW	15	35869395	missense	probably damaging	1.00
R3236:Vps13b	UTSW	15	35910304	missense	probably benign	0.40
R3404:Vps13b	UTSW	15	35926054	missense	probably damaging	1.00
R3722:Vps13b	UTSW	15	35671382	missense	probably damaging	0.99
R4077:Vps13b	UTSW	15	35455128	missense	probably damaging	0.99
R4153:Vps13b	UTSW	15	35792027	splice site	probably null
R4224:Vps13b	UTSW	15	35876419	missense	probably damaging	0.99
R4408:Vps13b	UTSW	15	35709294	missense	probably damaging	0.98
R4431:Vps13b	UTSW	15	35770753	missense	probably damaging	1.00
R4449:Vps13b	UTSW	15	35876793	missense	possibly damaging	0.86
R4508:Vps13b	UTSW	15	35709673	missense	possibly damaging	0.80
R4631:Vps13b	UTSW	15	35646132	missense	possibly damaging	0.95
R4655:Vps13b	UTSW	15	35770689	missense	probably benign
R4666:Vps13b	UTSW	15	35640544	missense	probably benign	0.13
R4684:Vps13b	UTSW	15	35646178	missense	probably damaging	0.98
R4684:Vps13b	UTSW	15	35841341	missense	probably benign
R4684:Vps13b	UTSW	15	35879821	missense	probably benign
R4721:Vps13b	UTSW	15	35910718	nonsense	probably null
R4771:Vps13b	UTSW	15	35910800	missense	probably damaging	1.00
R4830:Vps13b	UTSW	15	35452224	missense	possibly damaging	0.94
R4835:Vps13b	UTSW	15	35869372	missense	probably damaging	1.00
R4835:Vps13b	UTSW	15	35910293	missense	probably benign
R4891:Vps13b	UTSW	15	35640515	splice site	probably null
R5095:Vps13b	UTSW	15	35923202	missense	probably damaging	1.00
R5110:Vps13b	UTSW	15	35770809	missense	probably damaging	0.99
R5147:Vps13b	UTSW	15	35456678	missense	probably benign	0.32
R5153:Vps13b	UTSW	15	35422453	missense	probably damaging	0.99
R5257:Vps13b	UTSW	15	35794421	missense	possibly damaging	0.75
R5258:Vps13b	UTSW	15	35794421	missense	possibly damaging	0.75
R5296:Vps13b	UTSW	15	35876413	missense	probably damaging	1.00
R5386:Vps13b	UTSW	15	35640528	critical splice acceptor site	probably null
R5396:Vps13b	UTSW	15	35886948	missense	probably damaging	0.99
R5412:Vps13b	UTSW	15	35533385	missense	probably damaging	1.00
R5488:Vps13b	UTSW	15	35770542	missense	probably benign
R5489:Vps13b	UTSW	15	35770542	missense	probably benign
R5503:Vps13b	UTSW	15	35452166	missense	probably damaging	0.97
R5575:Vps13b	UTSW	15	35929919	missense	probably damaging	1.00
R5781:Vps13b	UTSW	15	35794035	missense	probably damaging	0.97
R5872:Vps13b	UTSW	15	35869351	missense	possibly damaging	0.56
R5876:Vps13b	UTSW	15	35917061	missense	probably damaging	0.99
R5994:Vps13b	UTSW	15	35875772	missense	probably damaging	1.00
R6031:Vps13b	UTSW	15	35471968	missense	probably damaging	1.00
R6031:Vps13b	UTSW	15	35471968	missense	probably damaging	1.00
R6045:Vps13b	UTSW	15	35671316	missense	probably damaging	0.99
R6143:Vps13b	UTSW	15	35668738	missense	probably damaging	0.99
R6147:Vps13b	UTSW	15	35930031	missense	probably benign	0.16
R6218:Vps13b	UTSW	15	35770464	missense	probably benign	0.00
R6447:Vps13b	UTSW	15	35572126	missense	probably benign	0.02
R6555:Vps13b	UTSW	15	35846847	missense	probably damaging	1.00
R6578:Vps13b	UTSW	15	35446101	missense	probably damaging	0.99
R6640:Vps13b	UTSW	15	35617696	missense	possibly damaging	0.93
R6645:Vps13b	UTSW	15	35910305	missense	probably benign	0.25
R6711:Vps13b	UTSW	15	35887249	missense	probably damaging	1.00
R6727:Vps13b	UTSW	15	35770683	missense	probably benign	0.19
R6737:Vps13b	UTSW	15	35910611	missense	probably damaging	1.00
R6844:Vps13b	UTSW	15	35877590	missense	probably benign	0.06
R6849:Vps13b	UTSW	15	35905309	missense	probably damaging	1.00
R6861:Vps13b	UTSW	15	35576395	missense	probably damaging	0.99
R6938:Vps13b	UTSW	15	35423198	missense	probably damaging	0.99
R6943:Vps13b	UTSW	15	35448689	missense	possibly damaging	0.95
R6989:Vps13b	UTSW	15	35448581	missense	probably benign	0.02
R7092:Vps13b	UTSW	15	35640634	missense	probably damaging	1.00
R7232:Vps13b	UTSW	15	35877557	missense	probably damaging	1.00
R7307:Vps13b	UTSW	15	35841545	missense	probably benign
R7400:Vps13b	UTSW	15	35378900	missense	probably damaging	1.00
R7414:Vps13b	UTSW	15	35910827	missense	probably damaging	1.00
R7497:Vps13b	UTSW	15	35876697	missense	probably benign	0.38
R7500:Vps13b	UTSW	15	35910524	missense	possibly damaging	0.74
R7603:Vps13b	UTSW	15	35576439	missense	probably damaging	0.98
R7605:Vps13b	UTSW	15	35770646	missense	probably damaging	0.97
R7849:Vps13b	UTSW	15	35423232	missense	probably damaging	0.99
R7984:Vps13b	UTSW	15	35879913	missense	probably benign
R8094:Vps13b	UTSW	15	35668906	critical splice donor site	probably null
R8097:Vps13b	UTSW	15	35709346	missense	probably benign	0.38
R8131:Vps13b	UTSW	15	35372109	critical splice donor site	probably null
R8139:Vps13b	UTSW	15	35607272	nonsense	probably null
R8174:Vps13b	UTSW	15	35709310	nonsense	probably null
R8225:Vps13b	UTSW	15	35794382	missense	probably damaging	0.99
R8239:Vps13b	UTSW	15	35597404	missense	probably damaging	1.00
R8244:Vps13b	UTSW	15	35917203	missense	probably damaging	1.00
R8303:Vps13b	UTSW	15	35639917	missense	probably damaging	1.00
R8311:Vps13b	UTSW	15	35886954	missense	probably benign	0.37
R8443:Vps13b	UTSW	15	35455100	missense	probably benign
R8494:Vps13b	UTSW	15	35422448	missense	probably damaging	0.99
R8499:Vps13b	UTSW	15	35841320	missense	probably damaging	1.00
R8506:Vps13b	UTSW	15	35446745	missense	probably benign	0.31
R8559:Vps13b	UTSW	15	35876642	missense	probably damaging	1.00
R8686:Vps13b	UTSW	15	35925389	missense	probably damaging	0.99
R8782:Vps13b	UTSW	15	35422337	missense	possibly damaging	0.93
R8806:Vps13b	UTSW	15	35472066	critical splice donor site	probably benign
R8824:Vps13b	UTSW	15	35533299	missense	probably damaging	0.99
R9024:Vps13b	UTSW	15	35923324	missense	probably damaging	0.97
R9038:Vps13b	UTSW	15	35875785	missense	possibly damaging	0.70
R9054:Vps13b	UTSW	15	35422391	missense	probably damaging	1.00
R9091:Vps13b	UTSW	15	35770773	missense	probably benign	0.13
R9129:Vps13b	UTSW	15	35448647	missense	probably damaging	1.00
R9214:Vps13b	UTSW	15	35623746	missense	probably damaging	0.99
R9237:Vps13b	UTSW	15	35841333	missense	probably damaging	1.00
R9256:Vps13b	UTSW	15	35623779	missense	possibly damaging	0.95
R9270:Vps13b	UTSW	15	35770773	missense	probably benign	0.13
R9279:Vps13b	UTSW	15	35572144	missense	probably damaging	0.97
R9291:Vps13b	UTSW	15	35846913	missense	probably damaging	1.00
R9342:Vps13b	UTSW	15	35455054	missense	possibly damaging	0.94
R9404:Vps13b	UTSW	15	35876419	missense	probably damaging	1.00
R9488:Vps13b	UTSW	15	35447734	missense	possibly damaging	0.77
R9509:Vps13b	UTSW	15	35841311	missense	possibly damaging	0.79
R9610:Vps13b	UTSW	15	35642409	missense	possibly damaging	0.85
R9611:Vps13b	UTSW	15	35642409	missense	possibly damaging	0.85
R9658:Vps13b	UTSW	15	35623628	missense	probably benign	0.00
R9674:Vps13b	UTSW	15	35607234	missense	probably damaging	0.98
R9696:Vps13b	UTSW	15	35674887	missense	possibly damaging	0.56
R9767:Vps13b	UTSW	15	35910257	missense	probably damaging	1.00
R9797:Vps13b	UTSW	15	35674876	missense	probably damaging	1.00
RF020:Vps13b	UTSW	15	35925406	missense	probably null	1.00
X0026:Vps13b	UTSW	15	35910646	missense	probably damaging	1.00
X0028:Vps13b	UTSW	15	35709431	missense	probably benign	0.00
Z1177:Vps13b	UTSW	15	35668885	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GCCCTGCTCTCAGTTTATAAATTGG -3'
(R):5'- CCTTCCACACATGTGCAATAGC -3'

Sequencing Primer
(F):5'- CTCTCAGTTTATAAATTGGTGGTTTG -3'
(R):5'- TGAATGCACATACATAGCACATG -3'

Posted On

2016-03-01