Incidental Mutation 'R4826:Nit1'
List |< first << previous [record 36 of 60] next >> last >|
ID374117
Institutional Source Beutler Lab
Gene Symbol Nit1
Ensembl Gene ENSMUSG00000013997
Gene Namenitrilase 1
SynonymsESTM30
MMRRC Submission 042442-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.555) question?
Stock #R4826 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location171338008-171345646 bp(-) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) T to C at 171345598 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006579] [ENSMUST00000064950] [ENSMUST00000097467] [ENSMUST00000111289] [ENSMUST00000111295] [ENSMUST00000111296] [ENSMUST00000111299] [ENSMUST00000111300] [ENSMUST00000129116] [ENSMUST00000135941] [ENSMUST00000156856] [ENSMUST00000148339]
Predicted Effect probably benign
Transcript: ENSMUST00000006579
SMART Domains Protein: ENSMUSP00000006579
Gene: ENSMUSG00000006412

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:Prefoldin_2 18 93 3e-24 PFAM
low complexity region 102 117 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064950
SMART Domains Protein: ENSMUSP00000068419
Gene: ENSMUSG00000013973

DomainStartEndE-ValueType
DED 24 103 1.34e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097467
SMART Domains Protein: ENSMUSP00000095075
Gene: ENSMUSG00000013973

DomainStartEndE-ValueType
DED 24 103 1.34e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111289
SMART Domains Protein: ENSMUSP00000106920
Gene: ENSMUSG00000013997

DomainStartEndE-ValueType
Pfam:CN_hydrolase 11 191 1.6e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111295
SMART Domains Protein: ENSMUSP00000106926
Gene: ENSMUSG00000013997

DomainStartEndE-ValueType
Pfam:CN_hydrolase 44 224 6.3e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111296
SMART Domains Protein: ENSMUSP00000106927
Gene: ENSMUSG00000013997

DomainStartEndE-ValueType
Pfam:CN_hydrolase 44 224 1.4e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111299
SMART Domains Protein: ENSMUSP00000106930
Gene: ENSMUSG00000013973

DomainStartEndE-ValueType
DED 24 103 1.34e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111300
SMART Domains Protein: ENSMUSP00000106931
Gene: ENSMUSG00000013973

DomainStartEndE-ValueType
DED 24 103 1.34e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129116
SMART Domains Protein: ENSMUSP00000120278
Gene: ENSMUSG00000013973

DomainStartEndE-ValueType
DED 24 103 1.34e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135941
SMART Domains Protein: ENSMUSP00000120106
Gene: ENSMUSG00000006412

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
Pfam:Prefoldin_2 24 129 3.3e-32 PFAM
low complexity region 139 150 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141357
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146428
Predicted Effect probably benign
Transcript: ENSMUST00000156856
SMART Domains Protein: ENSMUSP00000116835
Gene: ENSMUSG00000013997

DomainStartEndE-ValueType
Pfam:CN_hydrolase 11 131 5.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148339
SMART Domains Protein: ENSMUSP00000119171
Gene: ENSMUSG00000013997

DomainStartEndE-ValueType
Pfam:CN_hydrolase 11 87 8.8e-14 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nitrilase protein family with homology to bacterial and plant nitrilases, enzymes that cleave nitriles and organic amides to the corresponding carboxylic acids plus ammonia. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice that are either heterozygous or homozygous for a knock-out allele exhibit increased incidence of N-nitrosomethylbenzylamine (NMBA)-induced tumors in the forestomach (papillomas and dysplasias). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik G T 18: 12,185,779 probably benign Het
Abca14 A T 7: 120,216,247 R239S probably damaging Het
Acin1 A G 14: 54,664,617 S573P probably damaging Het
Acta2 A T 19: 34,251,823 Y55* probably null Het
Aifm2 T C 10: 61,725,989 M38T probably benign Het
Ank2 C A 3: 126,956,001 V460L probably benign Het
Ap1b1 T C 11: 5,018,043 S185P probably benign Het
Arsj A G 3: 126,438,802 Y399C probably damaging Het
Clec2d T C 6: 129,184,159 V73A probably benign Het
Cntln T G 4: 85,005,044 M582R probably benign Het
Cyp4a10 C T 4: 115,518,344 P8L probably benign Het
Dip2b A G 15: 100,169,281 N555D probably damaging Het
Dusp4 T A 8: 34,818,517 F311I probably damaging Het
Eif4g3 T C 4: 138,177,945 V1245A possibly damaging Het
Ephb3 G A 16: 21,214,995 R23H possibly damaging Het
Ext2 T C 2: 93,762,630 T410A probably benign Het
Fam193a A G 5: 34,436,531 E124G probably damaging Het
Fat4 T A 3: 38,982,957 V3586E probably damaging Het
Frmd4a T C 2: 4,601,297 S611P probably damaging Het
Gcn1l1 A G 5: 115,593,693 T956A probably benign Het
Gm10549 C A 18: 33,470,785 T107K unknown Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Herc6 T A 6: 57,647,087 M614K probably benign Het
Hspg2 T C 4: 137,565,395 C4095R probably damaging Het
Hyal5 T C 6: 24,891,576 I463T possibly damaging Het
Icam5 C T 9: 21,037,803 A817V possibly damaging Het
Igf2r A T 17: 12,701,353 D1366E probably damaging Het
Ints7 G A 1: 191,611,906 V553I probably damaging Het
Iqgap2 T A 13: 95,763,275 I92F probably damaging Het
Itgb1 T A 8: 128,720,308 C435S probably damaging Het
Lrrc71 T C 3: 87,743,308 M216V probably benign Het
Mgam T C 6: 40,680,648 V979A possibly damaging Het
Myh9 A T 15: 77,788,946 Y400* probably null Het
Narfl A G 17: 25,780,332 H240R probably damaging Het
Nbeal1 A G 1: 60,251,342 R1033G possibly damaging Het
Nlrp1c-ps A G 11: 71,242,517 noncoding transcript Het
Nt5c1a T C 4: 123,208,572 V97A probably damaging Het
Olfr1154 T A 2: 87,903,349 D109V probably damaging Het
Olfr358 A G 2: 37,005,333 Y94H probably damaging Het
Olfr43 A G 11: 74,206,331 M295T possibly damaging Het
Olfr46 T A 7: 140,610,319 M51K probably benign Het
Olfr683 G T 7: 105,143,968 N108K probably damaging Het
Pde4a T A 9: 21,192,380 probably null Het
Pkn2 T C 3: 142,809,509 K640R probably damaging Het
Pla2g6 A G 15: 79,308,679 S263P possibly damaging Het
Prkg1 A G 19: 31,764,606 S73P possibly damaging Het
Prr27 A C 5: 87,850,966 probably benign Het
Rad54b G T 4: 11,599,753 W319L probably damaging Het
Rassf8 T A 6: 145,816,550 L349H probably damaging Het
Rnf113a2 T A 12: 84,417,614 N93K probably benign Het
Sapcd2 C T 2: 25,372,756 A109V probably benign Het
Slamf9 C A 1: 172,476,441 H118N probably benign Het
Slc37a1 A G 17: 31,322,173 Y213C probably damaging Het
Slc5a1 A G 5: 33,159,150 D580G probably benign Het
Slc7a2 T A 8: 40,911,046 I432N probably damaging Het
Tas2r114 A T 6: 131,689,837 L76Q probably damaging Het
Tcerg1 C T 18: 42,535,115 P391L unknown Het
Tdrd12 A C 7: 35,504,157 V314G probably benign Het
Zbtb7b A G 3: 89,380,773 L246S probably benign Het
Other mutations in Nit1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01678:Nit1 APN 1 171342694 missense probably damaging 0.97
R4884:Nit1 UTSW 1 171343695 missense probably null 0.65
R6855:Nit1 UTSW 1 171343562 missense probably damaging 0.98
R7196:Nit1 UTSW 1 171344435 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAAGGAAAGTTCACCCTCCC -3'
(R):5'- TCTACACGAATTCGACACCG -3'

Sequencing Primer
(F):5'- GGAAAGTTCACCCTCCCTAGATCTC -3'
(R):5'- ACCTGTTCCGCCGACAC -3'
Posted On2016-03-01