Incidental Mutation 'R4826:Ext2'
List |< first << previous [record 16 of 60] next >> last >|
ID374124
Institutional Source Beutler Lab
Gene Symbol Ext2
Ensembl Gene ENSMUSG00000027198
Gene Nameexostoses (multiple) 2
Synonyms
MMRRC Submission 042442-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4826 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location93661028-93822568 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93762630 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 410 (T410A)
Ref Sequence ENSEMBL: ENSMUSP00000138956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028623] [ENSMUST00000125407] [ENSMUST00000184931]
Predicted Effect probably benign
Transcript: ENSMUST00000028623
AA Change: T410A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000028623
Gene: ENSMUSG00000027198
AA Change: T410A

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
Pfam:Exostosin 100 380 2.4e-59 PFAM
Pfam:Glyco_transf_64 456 701 1.1e-99 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123649
Predicted Effect probably benign
Transcript: ENSMUST00000125407
SMART Domains Protein: ENSMUSP00000120291
Gene: ENSMUSG00000027198

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
Pfam:Exostosin 100 380 8.8e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152344
Predicted Effect probably benign
Transcript: ENSMUST00000184931
AA Change: T410A

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000138956
Gene: ENSMUSG00000027198
AA Change: T410A

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
Pfam:Exostosin 100 380 1.4e-57 PFAM
Pfam:Glyco_transf_64 456 559 9.5e-31 PFAM
Meta Mutation Damage Score 0.1771 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two glycosyltransferases involved in the chain elongation step of heparan sulfate biosynthesis. Mutations in this gene cause the type II form of multiple exostoses. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos lack heparan sulfate, initiate primitive streak formation but fail to form mesoderm, become growth arrested and die around gastrulation. Heterozygotes show various abnormalities in cartilage differentiation; about one-third form one or more exostoses on the ribs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik G T 18: 12,185,779 probably benign Het
Abca14 A T 7: 120,216,247 R239S probably damaging Het
Acin1 A G 14: 54,664,617 S573P probably damaging Het
Acta2 A T 19: 34,251,823 Y55* probably null Het
Aifm2 T C 10: 61,725,989 M38T probably benign Het
Ank2 C A 3: 126,956,001 V460L probably benign Het
Ap1b1 T C 11: 5,018,043 S185P probably benign Het
Arsj A G 3: 126,438,802 Y399C probably damaging Het
Clec2d T C 6: 129,184,159 V73A probably benign Het
Cntln T G 4: 85,005,044 M582R probably benign Het
Cyp4a10 C T 4: 115,518,344 P8L probably benign Het
Dip2b A G 15: 100,169,281 N555D probably damaging Het
Dusp4 T A 8: 34,818,517 F311I probably damaging Het
Eif4g3 T C 4: 138,177,945 V1245A possibly damaging Het
Ephb3 G A 16: 21,214,995 R23H possibly damaging Het
Fam193a A G 5: 34,436,531 E124G probably damaging Het
Fat4 T A 3: 38,982,957 V3586E probably damaging Het
Frmd4a T C 2: 4,601,297 S611P probably damaging Het
Gcn1l1 A G 5: 115,593,693 T956A probably benign Het
Gm10549 C A 18: 33,470,785 T107K unknown Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Herc6 T A 6: 57,647,087 M614K probably benign Het
Hspg2 T C 4: 137,565,395 C4095R probably damaging Het
Hyal5 T C 6: 24,891,576 I463T possibly damaging Het
Icam5 C T 9: 21,037,803 A817V possibly damaging Het
Igf2r A T 17: 12,701,353 D1366E probably damaging Het
Ints7 G A 1: 191,611,906 V553I probably damaging Het
Iqgap2 T A 13: 95,763,275 I92F probably damaging Het
Itgb1 T A 8: 128,720,308 C435S probably damaging Het
Lrrc71 T C 3: 87,743,308 M216V probably benign Het
Mgam T C 6: 40,680,648 V979A possibly damaging Het
Myh9 A T 15: 77,788,946 Y400* probably null Het
Narfl A G 17: 25,780,332 H240R probably damaging Het
Nbeal1 A G 1: 60,251,342 R1033G possibly damaging Het
Nit1 T C 1: 171,345,598 probably benign Het
Nlrp1c-ps A G 11: 71,242,517 noncoding transcript Het
Nt5c1a T C 4: 123,208,572 V97A probably damaging Het
Olfr1154 T A 2: 87,903,349 D109V probably damaging Het
Olfr358 A G 2: 37,005,333 Y94H probably damaging Het
Olfr43 A G 11: 74,206,331 M295T possibly damaging Het
Olfr46 T A 7: 140,610,319 M51K probably benign Het
Olfr683 G T 7: 105,143,968 N108K probably damaging Het
Pde4a T A 9: 21,192,380 probably null Het
Pkn2 T C 3: 142,809,509 K640R probably damaging Het
Pla2g6 A G 15: 79,308,679 S263P possibly damaging Het
Prkg1 A G 19: 31,764,606 S73P possibly damaging Het
Prr27 A C 5: 87,850,966 probably benign Het
Rad54b G T 4: 11,599,753 W319L probably damaging Het
Rassf8 T A 6: 145,816,550 L349H probably damaging Het
Rnf113a2 T A 12: 84,417,614 N93K probably benign Het
Sapcd2 C T 2: 25,372,756 A109V probably benign Het
Slamf9 C A 1: 172,476,441 H118N probably benign Het
Slc37a1 A G 17: 31,322,173 Y213C probably damaging Het
Slc5a1 A G 5: 33,159,150 D580G probably benign Het
Slc7a2 T A 8: 40,911,046 I432N probably damaging Het
Tas2r114 A T 6: 131,689,837 L76Q probably damaging Het
Tcerg1 C T 18: 42,535,115 P391L unknown Het
Tdrd12 A C 7: 35,504,157 V314G probably benign Het
Zbtb7b A G 3: 89,380,773 L246S probably benign Het
Other mutations in Ext2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01132:Ext2 APN 2 93791073 missense probably benign
IGL01554:Ext2 APN 2 93811949 missense probably damaging 1.00
IGL01768:Ext2 APN 2 93791110 splice site probably benign
IGL02160:Ext2 APN 2 93813584 missense probably benign
IGL02677:Ext2 APN 2 93707245 missense probably damaging 1.00
IGL02939:Ext2 APN 2 93704619 splice site probably null
IGL03013:Ext2 APN 2 93707226 intron probably benign
IGL03286:Ext2 APN 2 93707272 missense probably damaging 1.00
R0018:Ext2 UTSW 2 93795692 missense probably damaging 1.00
R0526:Ext2 UTSW 2 93806085 missense probably damaging 0.99
R0580:Ext2 UTSW 2 93795725 missense probably benign 0.31
R1383:Ext2 UTSW 2 93806113 missense possibly damaging 0.92
R1538:Ext2 UTSW 2 93707287 missense probably damaging 1.00
R1743:Ext2 UTSW 2 93730225 missense probably damaging 1.00
R1792:Ext2 UTSW 2 93704545 missense probably damaging 1.00
R2874:Ext2 UTSW 2 93739686 missense possibly damaging 0.95
R3122:Ext2 UTSW 2 93813825 missense probably damaging 1.00
R4624:Ext2 UTSW 2 93703200 missense probably benign 0.26
R4653:Ext2 UTSW 2 93696159 missense probably benign 0.22
R4828:Ext2 UTSW 2 93795767 missense probably benign 0.08
R4936:Ext2 UTSW 2 93813679 nonsense probably null
R5311:Ext2 UTSW 2 93696261 missense probably benign 0.04
R5799:Ext2 UTSW 2 93811972 missense probably benign 0.01
R5850:Ext2 UTSW 2 93813659 missense possibly damaging 0.94
R6230:Ext2 UTSW 2 93762620 missense probably damaging 1.00
R6488:Ext2 UTSW 2 93806085 missense probably damaging 0.99
R7047:Ext2 UTSW 2 93739657 missense probably damaging 0.99
R7173:Ext2 UTSW 2 93813612 missense probably damaging 1.00
R7391:Ext2 UTSW 2 93730267 missense probably damaging 1.00
R7530:Ext2 UTSW 2 93661653 missense probably benign 0.00
R7545:Ext2 UTSW 2 93813763 missense probably benign
R7939:Ext2 UTSW 2 93730256 missense probably damaging 1.00
R8160:Ext2 UTSW 2 93813762 missense probably benign 0.05
Z1177:Ext2 UTSW 2 93703275 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- TGTTCATCTGAGACAGCAGC -3'
(R):5'- GCGACAACTCTGTGTACTTCC -3'

Sequencing Primer
(F):5'- GTTCATCTGAGACAGCAGCATTTC -3'
(R):5'- TGACTGCCATCTGATACAGCTGG -3'
Posted On2016-03-01