Incidental Mutation 'R4826:Lrrc71'
ID374126
Institutional Source Beutler Lab
Gene Symbol Lrrc71
Ensembl Gene ENSMUSG00000023084
Gene Nameleucine rich repeat containing 71
Synonyms
MMRRC Submission 042442-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4826 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location87736923-87748625 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87743308 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 216 (M216V)
Ref Sequence ENSEMBL: ENSMUSP00000023846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023846] [ENSMUST00000174267]
Predicted Effect probably benign
Transcript: ENSMUST00000023846
AA Change: M216V

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000023846
Gene: ENSMUSG00000023084
AA Change: M216V

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Blast:LRR 165 191 6e-7 BLAST
LRR 219 246 4.24e-1 SMART
LRR 251 278 1.33e-1 SMART
LRR 279 306 1.98e-4 SMART
low complexity region 312 323 N/A INTRINSIC
low complexity region 329 337 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
low complexity region 407 414 N/A INTRINSIC
LRR 472 499 1.83e2 SMART
low complexity region 547 557 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174208
Predicted Effect probably benign
Transcript: ENSMUST00000174267
SMART Domains Protein: ENSMUSP00000133626
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174381
Predicted Effect probably benign
Transcript: ENSMUST00000174581
SMART Domains Protein: ENSMUSP00000134711
Gene: ENSMUSG00000023084

DomainStartEndE-ValueType
Blast:LRR 67 94 1e-10 BLAST
low complexity region 142 152 N/A INTRINSIC
Meta Mutation Damage Score 0.2084 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik G T 18: 12,185,779 probably benign Het
Abca14 A T 7: 120,216,247 R239S probably damaging Het
Acin1 A G 14: 54,664,617 S573P probably damaging Het
Acta2 A T 19: 34,251,823 Y55* probably null Het
Aifm2 T C 10: 61,725,989 M38T probably benign Het
Ank2 C A 3: 126,956,001 V460L probably benign Het
Ap1b1 T C 11: 5,018,043 S185P probably benign Het
Arsj A G 3: 126,438,802 Y399C probably damaging Het
Clec2d T C 6: 129,184,159 V73A probably benign Het
Cntln T G 4: 85,005,044 M582R probably benign Het
Cyp4a10 C T 4: 115,518,344 P8L probably benign Het
Dip2b A G 15: 100,169,281 N555D probably damaging Het
Dusp4 T A 8: 34,818,517 F311I probably damaging Het
Eif4g3 T C 4: 138,177,945 V1245A possibly damaging Het
Ephb3 G A 16: 21,214,995 R23H possibly damaging Het
Ext2 T C 2: 93,762,630 T410A probably benign Het
Fam193a A G 5: 34,436,531 E124G probably damaging Het
Fat4 T A 3: 38,982,957 V3586E probably damaging Het
Frmd4a T C 2: 4,601,297 S611P probably damaging Het
Gcn1l1 A G 5: 115,593,693 T956A probably benign Het
Gm10549 C A 18: 33,470,785 T107K unknown Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Herc6 T A 6: 57,647,087 M614K probably benign Het
Hspg2 T C 4: 137,565,395 C4095R probably damaging Het
Hyal5 T C 6: 24,891,576 I463T possibly damaging Het
Icam5 C T 9: 21,037,803 A817V possibly damaging Het
Igf2r A T 17: 12,701,353 D1366E probably damaging Het
Ints7 G A 1: 191,611,906 V553I probably damaging Het
Iqgap2 T A 13: 95,763,275 I92F probably damaging Het
Itgb1 T A 8: 128,720,308 C435S probably damaging Het
Mgam T C 6: 40,680,648 V979A possibly damaging Het
Myh9 A T 15: 77,788,946 Y400* probably null Het
Narfl A G 17: 25,780,332 H240R probably damaging Het
Nbeal1 A G 1: 60,251,342 R1033G possibly damaging Het
Nit1 T C 1: 171,345,598 probably benign Het
Nlrp1c-ps A G 11: 71,242,517 noncoding transcript Het
Nt5c1a T C 4: 123,208,572 V97A probably damaging Het
Olfr1154 T A 2: 87,903,349 D109V probably damaging Het
Olfr358 A G 2: 37,005,333 Y94H probably damaging Het
Olfr43 A G 11: 74,206,331 M295T possibly damaging Het
Olfr46 T A 7: 140,610,319 M51K probably benign Het
Olfr683 G T 7: 105,143,968 N108K probably damaging Het
Pde4a T A 9: 21,192,380 probably null Het
Pkn2 T C 3: 142,809,509 K640R probably damaging Het
Pla2g6 A G 15: 79,308,679 S263P possibly damaging Het
Prkg1 A G 19: 31,764,606 S73P possibly damaging Het
Prr27 A C 5: 87,850,966 probably benign Het
Rad54b G T 4: 11,599,753 W319L probably damaging Het
Rassf8 T A 6: 145,816,550 L349H probably damaging Het
Rnf113a2 T A 12: 84,417,614 N93K probably benign Het
Sapcd2 C T 2: 25,372,756 A109V probably benign Het
Slamf9 C A 1: 172,476,441 H118N probably benign Het
Slc37a1 A G 17: 31,322,173 Y213C probably damaging Het
Slc5a1 A G 5: 33,159,150 D580G probably benign Het
Slc7a2 T A 8: 40,911,046 I432N probably damaging Het
Tas2r114 A T 6: 131,689,837 L76Q probably damaging Het
Tcerg1 C T 18: 42,535,115 P391L unknown Het
Tdrd12 A C 7: 35,504,157 V314G probably benign Het
Zbtb7b A G 3: 89,380,773 L246S probably benign Het
Other mutations in Lrrc71
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02030:Lrrc71 APN 3 87745224 splice site probably null
IGL02387:Lrrc71 APN 3 87743071 missense probably damaging 0.96
IGL02632:Lrrc71 APN 3 87743340 missense probably damaging 1.00
IGL02701:Lrrc71 APN 3 87741772 missense probably benign 0.37
R0372:Lrrc71 UTSW 3 87745777 missense probably benign 0.40
R0505:Lrrc71 UTSW 3 87745699 missense probably damaging 0.98
R0827:Lrrc71 UTSW 3 87742645 splice site probably null
R1511:Lrrc71 UTSW 3 87745484 missense probably benign 0.00
R1541:Lrrc71 UTSW 3 87741841 missense possibly damaging 0.87
R1987:Lrrc71 UTSW 3 87742643 missense probably benign 0.25
R2054:Lrrc71 UTSW 3 87742673 missense probably damaging 1.00
R2143:Lrrc71 UTSW 3 87745521 nonsense probably null
R2427:Lrrc71 UTSW 3 87746002 missense probably benign
R3700:Lrrc71 UTSW 3 87745878 splice site probably null
R4073:Lrrc71 UTSW 3 87745262 missense probably benign 0.01
R4231:Lrrc71 UTSW 3 87740991 missense probably benign 0.01
R4431:Lrrc71 UTSW 3 87742836 missense possibly damaging 0.59
R4477:Lrrc71 UTSW 3 87742665 missense probably damaging 0.99
R4562:Lrrc71 UTSW 3 87745408 unclassified probably benign
R4563:Lrrc71 UTSW 3 87745408 unclassified probably benign
R4564:Lrrc71 UTSW 3 87745408 unclassified probably benign
R4724:Lrrc71 UTSW 3 87739174 missense probably damaging 0.97
R5156:Lrrc71 UTSW 3 87745787 missense probably benign 0.07
R5631:Lrrc71 UTSW 3 87739149 missense probably benign 0.00
R6182:Lrrc71 UTSW 3 87745794 missense probably benign 0.41
R6558:Lrrc71 UTSW 3 87742643 missense probably benign 0.25
R6885:Lrrc71 UTSW 3 87742620 splice site probably null
R7036:Lrrc71 UTSW 3 87748386 missense probably benign 0.00
R7199:Lrrc71 UTSW 3 87743077 missense probably damaging 1.00
R7211:Lrrc71 UTSW 3 87743326 missense possibly damaging 0.92
R7634:Lrrc71 UTSW 3 87742974 missense probably damaging 1.00
R7638:Lrrc71 UTSW 3 87741806 missense probably damaging 1.00
R7695:Lrrc71 UTSW 3 87739462 missense probably damaging 1.00
Z1177:Lrrc71 UTSW 3 87742821 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGGAGAACCTGTATTCCTAGGG -3'
(R):5'- CTTTAGCCTGGGGAATTGTCC -3'

Sequencing Primer
(F):5'- AGAACCTGTATTCCTAGGGCTCAG -3'
(R):5'- AGCCTGGGGAATTGTCCTAGATG -3'
Posted On2016-03-01