Mutagenetix > Incidental Mutation

Incidental Mutation 'R4826:Mgam'

374143

Institutional Source

Beutler Lab

Gene Symbol

Mgam

Ensembl Gene

ENSMUSG00000068587

Gene Name

maltase-glucoamylase

Synonyms

6030407P20Rik

MMRRC Submission

042442-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.192) question?

Stock #

R4826 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

40628831-40769123 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 40680648 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 979 (V979A)

Ref Sequence

ENSEMBL: ENSMUSP00000143946 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071535] [ENSMUST00000201148] [ENSMUST00000202966]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000071535
AA Change: V979A

PolyPhen 2 Score 0.523 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000071466
Gene: ENSMUSG00000068587
AA Change: V979A

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	47	59	N/A	INTRINSIC
PD	63	111	1.81e-8	SMART
Pfam:NtCtMGAM_N	124	233	6.2e-36	PFAM
Pfam:Glyco_hydro_31	323	795	3.4e-145	PFAM
PD	924	977	4.52e-9	SMART
Pfam:NtCtMGAM_N	988	1101	1.5e-30	PFAM
Blast:ANK	1141	1171	1e-7	BLAST
Pfam:Glyco_hydro_31	1189	1691	2e-139	PFAM
low complexity region	1776	1791	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000201148
AA Change: V979A

PolyPhen 2 Score 0.523 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000143946
Gene: ENSMUSG00000068587
AA Change: V979A

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	47	59	N/A	INTRINSIC
PD	63	111	1.81e-8	SMART
Pfam:NtCtMGAM_N	124	233	6.2e-36	PFAM
Pfam:Glyco_hydro_31	323	795	3.4e-145	PFAM
PD	924	977	4.52e-9	SMART
Pfam:NtCtMGAM_N	988	1101	1.5e-30	PFAM
Blast:ANK	1141	1171	1e-7	BLAST
Pfam:Glyco_hydro_31	1189	1691	2e-139	PFAM
low complexity region	1776	1791	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000202966

SMART Domains

Protein: ENSMUSP00000144680
Gene: ENSMUSG00000068587

Domain	Start	End	E-Value	Type
internal_repeat_1	2	88	2.6e-19	PROSPERO
PD	178	231	1.4e-14	SMART
Pfam:NtCtMGAM_N	242	355	1.1e-26	PFAM
Blast:ANK	395	425	6e-8	BLAST
Pfam:Glyco_hydro_31	443	945	1.3e-137	PFAM

Meta Mutation Damage Score

0.1013

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes maltase-glucoamylase, which is a brush border membrane enzyme that plays a role in the final steps of digestion of starch. The protein has two catalytic sites identical to those of sucrase-isomaltase, but the proteins are only 59% homologous. Both are members of glycosyl hydrolase family 31, which has a variety of substrate specificities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display abnormalities in starch digestion and prandial glucose homeostasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110002H16Rik	G	T	18: 12,185,779		probably benign	Het
Abca14	A	T	7: 120,216,247	R239S	probably damaging	Het
Acin1	A	G	14: 54,664,617	S573P	probably damaging	Het
Acta2	A	T	19: 34,251,823	Y55*	probably null	Het
Aifm2	T	C	10: 61,725,989	M38T	probably benign	Het
Ank2	C	A	3: 126,956,001	V460L	probably benign	Het
Ap1b1	T	C	11: 5,018,043	S185P	probably benign	Het
Arsj	A	G	3: 126,438,802	Y399C	probably damaging	Het
Clec2d	T	C	6: 129,184,159	V73A	probably benign	Het
Cntln	T	G	4: 85,005,044	M582R	probably benign	Het
Cyp4a10	C	T	4: 115,518,344	P8L	probably benign	Het
Dip2b	A	G	15: 100,169,281	N555D	probably damaging	Het
Dusp4	T	A	8: 34,818,517	F311I	probably damaging	Het
Eif4g3	T	C	4: 138,177,945	V1245A	possibly damaging	Het
Ephb3	G	A	16: 21,214,995	R23H	possibly damaging	Het
Ext2	T	C	2: 93,762,630	T410A	probably benign	Het
Fam193a	A	G	5: 34,436,531	E124G	probably damaging	Het
Fat4	T	A	3: 38,982,957	V3586E	probably damaging	Het
Frmd4a	T	C	2: 4,601,297	S611P	probably damaging	Het
Gcn1l1	A	G	5: 115,593,693	T956A	probably benign	Het
Gm10549	C	A	18: 33,470,785	T107K	unknown	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Herc6	T	A	6: 57,647,087	M614K	probably benign	Het
Hspg2	T	C	4: 137,565,395	C4095R	probably damaging	Het
Hyal5	T	C	6: 24,891,576	I463T	possibly damaging	Het
Icam5	C	T	9: 21,037,803	A817V	possibly damaging	Het
Igf2r	A	T	17: 12,701,353	D1366E	probably damaging	Het
Ints7	G	A	1: 191,611,906	V553I	probably damaging	Het
Iqgap2	T	A	13: 95,763,275	I92F	probably damaging	Het
Itgb1	T	A	8: 128,720,308	C435S	probably damaging	Het
Lrrc71	T	C	3: 87,743,308	M216V	probably benign	Het
Myh9	A	T	15: 77,788,946	Y400*	probably null	Het
Narfl	A	G	17: 25,780,332	H240R	probably damaging	Het
Nbeal1	A	G	1: 60,251,342	R1033G	possibly damaging	Het
Nit1	T	C	1: 171,345,598		probably benign	Het
Nlrp1c-ps	A	G	11: 71,242,517		noncoding transcript	Het
Nt5c1a	T	C	4: 123,208,572	V97A	probably damaging	Het
Olfr1154	T	A	2: 87,903,349	D109V	probably damaging	Het
Olfr358	A	G	2: 37,005,333	Y94H	probably damaging	Het
Olfr43	A	G	11: 74,206,331	M295T	possibly damaging	Het
Olfr46	T	A	7: 140,610,319	M51K	probably benign	Het
Olfr683	G	T	7: 105,143,968	N108K	probably damaging	Het
Pde4a	T	A	9: 21,192,380		probably null	Het
Pkn2	T	C	3: 142,809,509	K640R	probably damaging	Het
Pla2g6	A	G	15: 79,308,679	S263P	possibly damaging	Het
Prkg1	A	G	19: 31,764,606	S73P	possibly damaging	Het
Prr27	A	C	5: 87,850,966		probably benign	Het
Rad54b	G	T	4: 11,599,753	W319L	probably damaging	Het
Rassf8	T	A	6: 145,816,550	L349H	probably damaging	Het
Rnf113a2	T	A	12: 84,417,614	N93K	probably benign	Het
Sapcd2	C	T	2: 25,372,756	A109V	probably benign	Het
Slamf9	C	A	1: 172,476,441	H118N	probably benign	Het
Slc37a1	A	G	17: 31,322,173	Y213C	probably damaging	Het
Slc5a1	A	G	5: 33,159,150	D580G	probably benign	Het
Slc7a2	T	A	8: 40,911,046	I432N	probably damaging	Het
Tas2r114	A	T	6: 131,689,837	L76Q	probably damaging	Het
Tcerg1	C	T	18: 42,535,115	P391L	unknown	Het
Tdrd12	A	C	7: 35,504,157	V314G	probably benign	Het
Zbtb7b	A	G	3: 89,380,773	L246S	probably benign	Het

Other mutations in Mgam

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Mgam	APN	6	40643010	missense	probably benign
IGL01065:Mgam	APN	6	40662710	critical splice donor site	probably null
IGL01402:Mgam	APN	6	40644945	missense	probably benign	0.01
IGL01404:Mgam	APN	6	40644945	missense	probably benign	0.01
IGL01413:Mgam	APN	6	40661277	missense	probably damaging	1.00
IGL01546:Mgam	APN	6	40654693	missense	probably damaging	0.98
IGL01596:Mgam	APN	6	40658270	missense	probably damaging	1.00
IGL02133:Mgam	APN	6	40643076	missense	probably damaging	0.98
IGL02734:Mgam	APN	6	40662694	missense	probably damaging	1.00
BB002:Mgam	UTSW	6	40759051	missense	probably damaging	0.99
BB012:Mgam	UTSW	6	40759051	missense	probably damaging	0.99
R0012:Mgam	UTSW	6	40765256	splice site	probably null
R0116:Mgam	UTSW	6	40658987	missense	probably damaging	1.00
R0310:Mgam	UTSW	6	40761035	splice site	probably benign
R0452:Mgam	UTSW	6	40759090	missense	probably damaging	1.00
R0497:Mgam	UTSW	6	40664892	missense	probably damaging	1.00
R0699:Mgam	UTSW	6	40643019	missense	possibly damaging	0.84
R0738:Mgam	UTSW	6	40754935	missense	probably benign	0.01
R1033:Mgam	UTSW	6	40680624	missense	probably benign	0.07
R1403:Mgam	UTSW	6	40666881	missense	possibly damaging	0.93
R1403:Mgam	UTSW	6	40666881	missense	possibly damaging	0.93
R1430:Mgam	UTSW	6	40756371	missense	probably benign	0.08
R1432:Mgam	UTSW	6	40756367	missense	probably damaging	1.00
R1443:Mgam	UTSW	6	40759780	nonsense	probably null
R1470:Mgam	UTSW	6	40759128	missense	probably damaging	1.00
R1470:Mgam	UTSW	6	40759128	missense	probably damaging	1.00
R1519:Mgam	UTSW	6	40661683	missense	probably benign	0.45
R1654:Mgam	UTSW	6	40757487	missense	probably damaging	1.00
R1667:Mgam	UTSW	6	40677044	missense	possibly damaging	0.62
R1730:Mgam	UTSW	6	40664860	missense	possibly damaging	0.92
R1781:Mgam	UTSW	6	40669863	missense	probably damaging	1.00
R1783:Mgam	UTSW	6	40664860	missense	possibly damaging	0.92
R1829:Mgam	UTSW	6	40666892	missense	probably damaging	1.00
R1833:Mgam	UTSW	6	40654718	critical splice donor site	probably null
R1872:Mgam	UTSW	6	40661300	nonsense	probably null
R1912:Mgam	UTSW	6	40764185	nonsense	probably null
R1977:Mgam	UTSW	6	40664880	missense	probably benign	0.01
R2048:Mgam	UTSW	6	40656429	missense	possibly damaging	0.80
R2086:Mgam	UTSW	6	40761028	splice site	probably null
R2138:Mgam	UTSW	6	40756450	missense	probably damaging	1.00
R2224:Mgam	UTSW	6	40764274	splice site	probably null
R2408:Mgam	UTSW	6	40686522	missense	probably damaging	1.00
R2508:Mgam	UTSW	6	40759783	missense	probably damaging	1.00
R2842:Mgam	UTSW	6	40661345	missense	probably benign	0.01
R2847:Mgam	UTSW	6	40652715	missense	possibly damaging	0.67
R2848:Mgam	UTSW	6	40652715	missense	possibly damaging	0.67
R2965:Mgam	UTSW	6	40768220	missense	possibly damaging	0.46
R2966:Mgam	UTSW	6	40768220	missense	possibly damaging	0.46
R3035:Mgam	UTSW	6	40663530	missense	probably benign
R3895:Mgam	UTSW	6	40759120	missense	probably damaging	1.00
R4027:Mgam	UTSW	6	40754902	missense	probably damaging	1.00
R4030:Mgam	UTSW	6	40754902	missense	probably damaging	1.00
R4302:Mgam	UTSW	6	40763085	missense	probably benign	0.02
R4707:Mgam	UTSW	6	40714632	splice site	probably null
R4898:Mgam	UTSW	6	40643054	missense	probably benign
R5438:Mgam	UTSW	6	40684521	missense	probably damaging	1.00
R5492:Mgam	UTSW	6	40756363	missense	probably damaging	1.00
R5770:Mgam	UTSW	6	40669804	missense	probably benign	0.01
R5839:Mgam	UTSW	6	40740064	missense	possibly damaging	0.90
R5845:Mgam	UTSW	6	40675323	missense	possibly damaging	0.78
R5847:Mgam	UTSW	6	40684055	missense	probably benign	0.42
R5891:Mgam	UTSW	6	40744348	missense	probably benign
R6158:Mgam	UTSW	6	40757714	missense	probably damaging	1.00
R6193:Mgam	UTSW	6	40747920	nonsense	probably null
R6423:Mgam	UTSW	6	40677045	missense	possibly damaging	0.84
R6706:Mgam	UTSW	6	40744786	missense	probably benign	0.00
R6813:Mgam	UTSW	6	40750165	missense	probably damaging	0.99
R6863:Mgam	UTSW	6	40729009	missense	probably benign	0.00
R6906:Mgam	UTSW	6	40747919	missense	probably damaging	1.00
R7091:Mgam	UTSW	6	40768276	missense	possibly damaging	0.95
R7099:Mgam	UTSW	6	40661716	missense	probably benign	0.09
R7282:Mgam	UTSW	6	40656512	missense	possibly damaging	0.71
R7282:Mgam	UTSW	6	40763111	missense	probably benign
R7354:Mgam	UTSW	6	40744798	missense	probably damaging	1.00
R7374:Mgam	UTSW	6	40757439	missense	possibly damaging	0.89
R7399:Mgam	UTSW	6	40666854	missense	probably damaging	0.99
R7406:Mgam	UTSW	6	40663525	missense	probably benign	0.13
R7446:Mgam	UTSW	6	40746332	missense	probably damaging	1.00
R7466:Mgam	UTSW	6	40744789	missense	probably benign	0.00
R7525:Mgam	UTSW	6	40766020	missense	probably benign	0.01
R7530:Mgam	UTSW	6	40709218	splice site	probably null
R7570:Mgam	UTSW	6	40746433	missense	probably benign	0.16
R7669:Mgam	UTSW	6	40659010	missense	probably benign	0.00
R7679:Mgam	UTSW	6	40643046	missense	probably damaging	0.98
R7746:Mgam	UTSW	6	40668193	missense	probably damaging	0.99
R7859:Mgam	UTSW	6	40740179	missense	possibly damaging	0.75
R7925:Mgam	UTSW	6	40759051	missense	probably damaging	0.99
R8206:Mgam	UTSW	6	40680235	missense	probably benign	0.00
R8244:Mgam	UTSW	6	40750586	missense	probably damaging	1.00
R8309:Mgam	UTSW	6	40745177	missense	possibly damaging	0.88
R8472:Mgam	UTSW	6	40694526	splice site	probably null
R8758:Mgam	UTSW	6	40729043	missense	probably benign	0.41
R8777:Mgam	UTSW	6	40655251	missense	probably damaging	0.97
R8777-TAIL:Mgam	UTSW	6	40655251	missense	probably damaging	0.97
R8783:Mgam	UTSW	6	40656489	missense	probably damaging	0.99
R8939:Mgam	UTSW	6	40763203	critical splice donor site	probably null
R8968:Mgam	UTSW	6	40757811	critical splice acceptor site	probably null
R8987:Mgam	UTSW	6	40729636	missense	probably damaging	1.00
R9055:Mgam	UTSW	6	40714729	intron	probably benign
R9171:Mgam	UTSW	6	40768212	missense	possibly damaging	0.76
R9252:Mgam	UTSW	6	40729643	missense	probably damaging	0.99
R9258:Mgam	UTSW	6	40680187	missense	probably benign
R9262:Mgam	UTSW	6	40746488	critical splice donor site	probably null
R9287:Mgam	UTSW	6	40728971	intron	probably benign
R9521:Mgam	UTSW	6	40745184	missense	probably damaging	1.00
R9589:Mgam	UTSW	6	40750585	missense	probably damaging	1.00
R9658:Mgam	UTSW	6	40744377	missense	possibly damaging	0.93
R9784:Mgam	UTSW	6	40759090	missense	probably damaging	1.00
RF011:Mgam	UTSW	6	40757436	missense	probably damaging	1.00
RF020:Mgam	UTSW	6	40685309	missense	probably damaging	1.00
RF023:Mgam	UTSW	6	40680708	missense	probably benign
X0021:Mgam	UTSW	6	40659047	missense	probably damaging	1.00
Z1088:Mgam	UTSW	6	40643060	missense	probably benign	0.01
Z1176:Mgam	UTSW	6	40677644	critical splice donor site	probably null
Z1176:Mgam	UTSW	6	40729066	missense	probably damaging	1.00
Z1177:Mgam	UTSW	6	40740071	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCATTATCAAGGTTGAGGAGTGGG -3'
(R):5'- CCCTGTCCACACCTGATAGTAC -3'

Sequencing Primer
(F):5'- CTCCAGCAGAGCAGGGATTTAAATTC -3'
(R):5'- CATACCTTAAACTGCAGCATTTCG -3'

Posted On

2016-03-01