Incidental Mutation 'R4826:Olfr46'
ID 374151
Institutional Source Beutler Lab
Gene Symbol Olfr46
Ensembl Gene ENSMUSG00000093942
Gene Name olfactory receptor 46
Synonyms ID12, IF5, MOR253-8, GA_x6K02T2PBJ9-42759973-42760905, IB7
MMRRC Submission 042442-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R4826 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 140601269-140617678 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 140610319 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 51 (M51K)
Ref Sequence ENSEMBL: ENSMUSP00000072445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072655] [ENSMUST00000211771] [ENSMUST00000214180]
AlphaFold Q8VGJ4
Predicted Effect probably benign
Transcript: ENSMUST00000072655
AA Change: M51K

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000072445
Gene: ENSMUSG00000093942
AA Change: M51K

DomainStartEndE-ValueType
Pfam:7tm_4 39 315 1.1e-50 PFAM
Pfam:7TM_GPCR_Srsx 43 209 5.9e-8 PFAM
Pfam:7tm_1 49 298 3.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211771
AA Change: M43K

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000214180
AA Change: M43K

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Meta Mutation Damage Score 0.3096 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik G T 18: 12,185,779 probably benign Het
Abca14 A T 7: 120,216,247 R239S probably damaging Het
Acin1 A G 14: 54,664,617 S573P probably damaging Het
Acta2 A T 19: 34,251,823 Y55* probably null Het
Aifm2 T C 10: 61,725,989 M38T probably benign Het
Ank2 C A 3: 126,956,001 V460L probably benign Het
Ap1b1 T C 11: 5,018,043 S185P probably benign Het
Arsj A G 3: 126,438,802 Y399C probably damaging Het
Clec2d T C 6: 129,184,159 V73A probably benign Het
Cntln T G 4: 85,005,044 M582R probably benign Het
Cyp4a10 C T 4: 115,518,344 P8L probably benign Het
Dip2b A G 15: 100,169,281 N555D probably damaging Het
Dusp4 T A 8: 34,818,517 F311I probably damaging Het
Eif4g3 T C 4: 138,177,945 V1245A possibly damaging Het
Ephb3 G A 16: 21,214,995 R23H possibly damaging Het
Ext2 T C 2: 93,762,630 T410A probably benign Het
Fam193a A G 5: 34,436,531 E124G probably damaging Het
Fat4 T A 3: 38,982,957 V3586E probably damaging Het
Frmd4a T C 2: 4,601,297 S611P probably damaging Het
Gcn1l1 A G 5: 115,593,693 T956A probably benign Het
Gm10549 C A 18: 33,470,785 T107K unknown Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Herc6 T A 6: 57,647,087 M614K probably benign Het
Hspg2 T C 4: 137,565,395 C4095R probably damaging Het
Hyal5 T C 6: 24,891,576 I463T possibly damaging Het
Icam5 C T 9: 21,037,803 A817V possibly damaging Het
Igf2r A T 17: 12,701,353 D1366E probably damaging Het
Ints7 G A 1: 191,611,906 V553I probably damaging Het
Iqgap2 T A 13: 95,763,275 I92F probably damaging Het
Itgb1 T A 8: 128,720,308 C435S probably damaging Het
Lrrc71 T C 3: 87,743,308 M216V probably benign Het
Mgam T C 6: 40,680,648 V979A possibly damaging Het
Myh9 A T 15: 77,788,946 Y400* probably null Het
Narfl A G 17: 25,780,332 H240R probably damaging Het
Nbeal1 A G 1: 60,251,342 R1033G possibly damaging Het
Nit1 T C 1: 171,345,598 probably benign Het
Nlrp1c-ps A G 11: 71,242,517 noncoding transcript Het
Nt5c1a T C 4: 123,208,572 V97A probably damaging Het
Olfr1154 T A 2: 87,903,349 D109V probably damaging Het
Olfr358 A G 2: 37,005,333 Y94H probably damaging Het
Olfr43 A G 11: 74,206,331 M295T possibly damaging Het
Olfr683 G T 7: 105,143,968 N108K probably damaging Het
Pde4a T A 9: 21,192,380 probably null Het
Pkn2 T C 3: 142,809,509 K640R probably damaging Het
Pla2g6 A G 15: 79,308,679 S263P possibly damaging Het
Prkg1 A G 19: 31,764,606 S73P possibly damaging Het
Prr27 A C 5: 87,850,966 probably benign Het
Rad54b G T 4: 11,599,753 W319L probably damaging Het
Rassf8 T A 6: 145,816,550 L349H probably damaging Het
Rnf113a2 T A 12: 84,417,614 N93K probably benign Het
Sapcd2 C T 2: 25,372,756 A109V probably benign Het
Slamf9 C A 1: 172,476,441 H118N probably benign Het
Slc37a1 A G 17: 31,322,173 Y213C probably damaging Het
Slc5a1 A G 5: 33,159,150 D580G probably benign Het
Slc7a2 T A 8: 40,911,046 I432N probably damaging Het
Tas2r114 A T 6: 131,689,837 L76Q probably damaging Het
Tcerg1 C T 18: 42,535,115 P391L unknown Het
Tdrd12 A C 7: 35,504,157 V314G probably benign Het
Zbtb7b A G 3: 89,380,773 L246S probably benign Het
Other mutations in Olfr46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Olfr46 APN 7 140610753 missense probably damaging 1.00
IGL02408:Olfr46 APN 7 140610931 missense probably damaging 1.00
IGL02496:Olfr46 APN 7 140610168 start codon destroyed probably benign
IGL03003:Olfr46 APN 7 140610370 missense probably damaging 1.00
R0538:Olfr46 UTSW 7 140610384 missense probably damaging 1.00
R1350:Olfr46 UTSW 7 140610709 missense probably damaging 0.96
R1466:Olfr46 UTSW 7 140610969 missense probably benign 0.01
R1466:Olfr46 UTSW 7 140610969 missense probably benign 0.01
R2008:Olfr46 UTSW 7 140610585 missense probably damaging 1.00
R4110:Olfr46 UTSW 7 140610264 missense probably benign 0.20
R4110:Olfr46 UTSW 7 140610265 missense possibly damaging 0.89
R4255:Olfr46 UTSW 7 140610587 nonsense probably null
R4622:Olfr46 UTSW 7 140610698 nonsense probably null
R4809:Olfr46 UTSW 7 140611074 missense probably damaging 0.98
R4989:Olfr46 UTSW 7 140610391 missense possibly damaging 0.95
R5177:Olfr46 UTSW 7 140610189 missense probably benign 0.00
R5261:Olfr46 UTSW 7 140610663 missense probably benign 0.00
R5770:Olfr46 UTSW 7 140610943 missense probably damaging 1.00
R5863:Olfr46 UTSW 7 140610631 missense probably damaging 0.97
R6082:Olfr46 UTSW 7 140610681 missense probably benign 0.00
R6705:Olfr46 UTSW 7 140610784 missense probably damaging 0.99
R7216:Olfr46 UTSW 7 140610460 missense possibly damaging 0.87
R7443:Olfr46 UTSW 7 140611048 missense probably damaging 1.00
R7485:Olfr46 UTSW 7 140610178 missense probably benign 0.02
R7806:Olfr46 UTSW 7 140610772 missense probably benign 0.00
R8373:Olfr46 UTSW 7 140610295 missense possibly damaging 0.88
R8884:Olfr46 UTSW 7 140610703 missense probably damaging 1.00
R9278:Olfr46 UTSW 7 140611023 missense probably damaging 1.00
R9595:Olfr46 UTSW 7 140611026 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTTCTCAGAAGCCAATCCATACCTC -3'
(R):5'- TCATAGGCCATGACTGTGAGC -3'

Sequencing Primer
(F):5'- GCCAATCCATACCTCTATGAACTGG -3'
(R):5'- CATGACTGTGAGCAGCAGC -3'
Posted On 2016-03-01