Incidental Mutation 'R4826:Icam5'
List |< first << previous [record 26 of 60] next >> last >|
ID374154
Institutional Source Beutler Lab
Gene Symbol Icam5
Ensembl Gene ENSMUSG00000032174
Gene Nameintercellular adhesion molecule 5, telencephalin
SynonymsTlcn, TLN, Icam3, CD50
MMRRC Submission 042442-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4826 (G1)
Quality Score155
Status Validated
Chromosome9
Chromosomal Location21032073-21039036 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 21037803 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 817 (A817V)
Ref Sequence ENSEMBL: ENSMUSP00000019616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019616]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019616
AA Change: A817V

PolyPhen 2 Score 0.666 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000019616
Gene: ENSMUSG00000032174
AA Change: A817V

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
Pfam:ICAM_N 32 122 1.5e-17 PFAM
Pfam:Ig_3 121 202 5.6e-4 PFAM
low complexity region 284 292 N/A INTRINSIC
IG_like 329 405 1.45e1 SMART
IG 416 488 1.72e-2 SMART
IG 499 569 5.84e-5 SMART
IG_like 580 662 3.57e1 SMART
IG 673 742 3.49e-3 SMART
IGc2 758 819 1.97e-11 SMART
transmembrane domain 833 855 N/A INTRINSIC
low complexity region 884 902 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180870
Meta Mutation Damage Score 0.0832 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the intercellular adhesion molecule (ICAM) family. All ICAM proteins are type I transmembrane glycoproteins, contain 2-9 immunoglobulin-like C2-type domains, and bind to the leukocyte adhesion LFA-1 protein. This protein is expressed on the surface of telencephalic neurons and displays two types of adhesion activity, homophilic binding between neurons and heterophilic binding between neurons and leukocytes. It may be a critical component in neuron-microglial cell interactions in the course of normal development or as part of neurodegenerative diseases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit enhanced long-term potentiation, sensorimotor gating, and reward-based learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik G T 18: 12,185,779 probably benign Het
Abca14 A T 7: 120,216,247 R239S probably damaging Het
Acin1 A G 14: 54,664,617 S573P probably damaging Het
Acta2 A T 19: 34,251,823 Y55* probably null Het
Aifm2 T C 10: 61,725,989 M38T probably benign Het
Ank2 C A 3: 126,956,001 V460L probably benign Het
Ap1b1 T C 11: 5,018,043 S185P probably benign Het
Arsj A G 3: 126,438,802 Y399C probably damaging Het
Clec2d T C 6: 129,184,159 V73A probably benign Het
Cntln T G 4: 85,005,044 M582R probably benign Het
Cyp4a10 C T 4: 115,518,344 P8L probably benign Het
Dip2b A G 15: 100,169,281 N555D probably damaging Het
Dusp4 T A 8: 34,818,517 F311I probably damaging Het
Eif4g3 T C 4: 138,177,945 V1245A possibly damaging Het
Ephb3 G A 16: 21,214,995 R23H possibly damaging Het
Ext2 T C 2: 93,762,630 T410A probably benign Het
Fam193a A G 5: 34,436,531 E124G probably damaging Het
Fat4 T A 3: 38,982,957 V3586E probably damaging Het
Frmd4a T C 2: 4,601,297 S611P probably damaging Het
Gcn1l1 A G 5: 115,593,693 T956A probably benign Het
Gm10549 C A 18: 33,470,785 T107K unknown Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Herc6 T A 6: 57,647,087 M614K probably benign Het
Hspg2 T C 4: 137,565,395 C4095R probably damaging Het
Hyal5 T C 6: 24,891,576 I463T possibly damaging Het
Igf2r A T 17: 12,701,353 D1366E probably damaging Het
Ints7 G A 1: 191,611,906 V553I probably damaging Het
Iqgap2 T A 13: 95,763,275 I92F probably damaging Het
Itgb1 T A 8: 128,720,308 C435S probably damaging Het
Lrrc71 T C 3: 87,743,308 M216V probably benign Het
Mgam T C 6: 40,680,648 V979A possibly damaging Het
Myh9 A T 15: 77,788,946 Y400* probably null Het
Narfl A G 17: 25,780,332 H240R probably damaging Het
Nbeal1 A G 1: 60,251,342 R1033G possibly damaging Het
Nit1 T C 1: 171,345,598 probably benign Het
Nlrp1c-ps A G 11: 71,242,517 noncoding transcript Het
Nt5c1a T C 4: 123,208,572 V97A probably damaging Het
Olfr1154 T A 2: 87,903,349 D109V probably damaging Het
Olfr358 A G 2: 37,005,333 Y94H probably damaging Het
Olfr43 A G 11: 74,206,331 M295T possibly damaging Het
Olfr46 T A 7: 140,610,319 M51K probably benign Het
Olfr683 G T 7: 105,143,968 N108K probably damaging Het
Pde4a T A 9: 21,192,380 probably null Het
Pkn2 T C 3: 142,809,509 K640R probably damaging Het
Pla2g6 A G 15: 79,308,679 S263P possibly damaging Het
Prkg1 A G 19: 31,764,606 S73P possibly damaging Het
Prr27 A C 5: 87,850,966 probably benign Het
Rad54b G T 4: 11,599,753 W319L probably damaging Het
Rassf8 T A 6: 145,816,550 L349H probably damaging Het
Rnf113a2 T A 12: 84,417,614 N93K probably benign Het
Sapcd2 C T 2: 25,372,756 A109V probably benign Het
Slamf9 C A 1: 172,476,441 H118N probably benign Het
Slc37a1 A G 17: 31,322,173 Y213C probably damaging Het
Slc5a1 A G 5: 33,159,150 D580G probably benign Het
Slc7a2 T A 8: 40,911,046 I432N probably damaging Het
Tas2r114 A T 6: 131,689,837 L76Q probably damaging Het
Tcerg1 C T 18: 42,535,115 P391L unknown Het
Tdrd12 A C 7: 35,504,157 V314G probably benign Het
Zbtb7b A G 3: 89,380,773 L246S probably benign Het
Other mutations in Icam5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Icam5 APN 9 21036795 critical splice donor site probably null
IGL00972:Icam5 APN 9 21034697 missense probably damaging 0.99
IGL01690:Icam5 APN 9 21034799 missense possibly damaging 0.69
IGL02334:Icam5 APN 9 21035209 missense possibly damaging 0.92
IGL03387:Icam5 APN 9 21033801 missense probably benign 0.10
H8562:Icam5 UTSW 9 21035146 missense probably benign 0.04
R0002:Icam5 UTSW 9 21033505 missense probably benign 0.00
R0594:Icam5 UTSW 9 21035598 missense probably benign 0.11
R0605:Icam5 UTSW 9 21032197 missense probably benign 0.23
R1485:Icam5 UTSW 9 21036406 missense probably benign 0.34
R1773:Icam5 UTSW 9 21033525 missense possibly damaging 0.67
R1934:Icam5 UTSW 9 21034786 missense probably benign 0.32
R3125:Icam5 UTSW 9 21036658 missense probably benign 0.00
R4117:Icam5 UTSW 9 21037590 missense probably damaging 0.99
R4132:Icam5 UTSW 9 21036657 missense probably benign
R4250:Icam5 UTSW 9 21037739 missense probably damaging 0.98
R4470:Icam5 UTSW 9 21035506 nonsense probably null
R4471:Icam5 UTSW 9 21035506 nonsense probably null
R5182:Icam5 UTSW 9 21034810 missense probably benign
R5586:Icam5 UTSW 9 21034820 missense probably damaging 0.98
R6200:Icam5 UTSW 9 21038749 missense probably damaging 1.00
R6240:Icam5 UTSW 9 21033158 missense possibly damaging 0.80
R6291:Icam5 UTSW 9 21036921 missense probably benign 0.07
R7229:Icam5 UTSW 9 21037001 missense possibly damaging 0.79
R7395:Icam5 UTSW 9 21035442 missense possibly damaging 0.77
R7414:Icam5 UTSW 9 21037593 missense probably damaging 0.98
R7423:Icam5 UTSW 9 21036905 missense probably benign
R7961:Icam5 UTSW 9 21038755 missense possibly damaging 0.85
R8032:Icam5 UTSW 9 21033218 missense probably benign 0.35
R8286:Icam5 UTSW 9 21035526 missense possibly damaging 0.71
Z1177:Icam5 UTSW 9 21035548 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GCTAAGCAGCGTCTTCATCTCC -3'
(R):5'- GCTCTTGGCCTCTACATTGG -3'

Sequencing Primer
(F):5'- TCATCTCCCTGCAGACCGG -3'
(R):5'- GCCCCTTTTGGTCTTGCATACAG -3'
Posted On2016-03-01