Incidental Mutation 'R4826:Myh9'
List |< first << previous [record 33 of 60] next >> last >|
ID374163
Institutional Source Beutler Lab
Gene Symbol Myh9
Ensembl Gene ENSMUSG00000022443
Gene Namemyosin, heavy polypeptide 9, non-muscle
SynonymsNMHC II-A, D0Jmb2, myosin IIA, Fltn, Myhn1, Myhn-1, E030044M24Rik
MMRRC Submission 042442-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4826 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location77760587-77842175 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 77788946 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 400 (Y400*)
Ref Sequence ENSEMBL: ENSMUSP00000016771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016771] [ENSMUST00000123101]
Predicted Effect probably null
Transcript: ENSMUST00000016771
AA Change: Y400*
SMART Domains Protein: ENSMUSP00000016771
Gene: ENSMUSG00000022443
AA Change: Y400*

DomainStartEndE-ValueType
Pfam:Myosin_N 29 69 3.4e-11 PFAM
MYSc 75 777 N/A SMART
IQ 778 800 1.46e-3 SMART
Pfam:Myosin_tail_1 841 1921 N/A PFAM
low complexity region 1948 1959 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123101
SMART Domains Protein: ENSMUSP00000116198
Gene: ENSMUSG00000022443

DomainStartEndE-ValueType
Pfam:Myosin_N 29 71 6.8e-15 PFAM
Pfam:Myosin_head 83 114 5.9e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126796
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129453
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conventional non-muscle myosin; this protein should not be confused with the unconventional myosin-9a or 9b (MYO9A or MYO9B). The encoded protein is a myosin IIA heavy chain that contains an IQ domain and a myosin head-like domain which is involved in several important functions, including cytokinesis, cell motility and maintenance of cell shape. Defects in this gene have been associated with non-syndromic sensorineural deafness autosomal dominant type 17, Epstein syndrome, Alport syndrome with macrothrombocytopenia, Sebastian syndrome, Fechtner syndrome and macrothrombocytopenia with progressive sensorineural deafness. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mice display embryonic lethality. Heterozygous null mice display hearing loss with incomplete penetrance. Mice homozygous or heterozygous for one of several knock-in alleles exhibit macrothrombocytopenia, nephritis, cataracts and deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik G T 18: 12,185,779 probably benign Het
Abca14 A T 7: 120,216,247 R239S probably damaging Het
Acin1 A G 14: 54,664,617 S573P probably damaging Het
Acta2 A T 19: 34,251,823 Y55* probably null Het
Aifm2 T C 10: 61,725,989 M38T probably benign Het
Ank2 C A 3: 126,956,001 V460L probably benign Het
Ap1b1 T C 11: 5,018,043 S185P probably benign Het
Arsj A G 3: 126,438,802 Y399C probably damaging Het
Clec2d T C 6: 129,184,159 V73A probably benign Het
Cntln T G 4: 85,005,044 M582R probably benign Het
Cyp4a10 C T 4: 115,518,344 P8L probably benign Het
Dip2b A G 15: 100,169,281 N555D probably damaging Het
Dusp4 T A 8: 34,818,517 F311I probably damaging Het
Eif4g3 T C 4: 138,177,945 V1245A possibly damaging Het
Ephb3 G A 16: 21,214,995 R23H possibly damaging Het
Ext2 T C 2: 93,762,630 T410A probably benign Het
Fam193a A G 5: 34,436,531 E124G probably damaging Het
Fat4 T A 3: 38,982,957 V3586E probably damaging Het
Frmd4a T C 2: 4,601,297 S611P probably damaging Het
Gcn1l1 A G 5: 115,593,693 T956A probably benign Het
Gm10549 C A 18: 33,470,785 T107K unknown Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Herc6 T A 6: 57,647,087 M614K probably benign Het
Hspg2 T C 4: 137,565,395 C4095R probably damaging Het
Hyal5 T C 6: 24,891,576 I463T possibly damaging Het
Icam5 C T 9: 21,037,803 A817V possibly damaging Het
Igf2r A T 17: 12,701,353 D1366E probably damaging Het
Ints7 G A 1: 191,611,906 V553I probably damaging Het
Iqgap2 T A 13: 95,763,275 I92F probably damaging Het
Itgb1 T A 8: 128,720,308 C435S probably damaging Het
Lrrc71 T C 3: 87,743,308 M216V probably benign Het
Mgam T C 6: 40,680,648 V979A possibly damaging Het
Narfl A G 17: 25,780,332 H240R probably damaging Het
Nbeal1 A G 1: 60,251,342 R1033G possibly damaging Het
Nit1 T C 1: 171,345,598 probably benign Het
Nlrp1c-ps A G 11: 71,242,517 noncoding transcript Het
Nt5c1a T C 4: 123,208,572 V97A probably damaging Het
Olfr1154 T A 2: 87,903,349 D109V probably damaging Het
Olfr358 A G 2: 37,005,333 Y94H probably damaging Het
Olfr43 A G 11: 74,206,331 M295T possibly damaging Het
Olfr46 T A 7: 140,610,319 M51K probably benign Het
Olfr683 G T 7: 105,143,968 N108K probably damaging Het
Pde4a T A 9: 21,192,380 probably null Het
Pkn2 T C 3: 142,809,509 K640R probably damaging Het
Pla2g6 A G 15: 79,308,679 S263P possibly damaging Het
Prkg1 A G 19: 31,764,606 S73P possibly damaging Het
Prr27 A C 5: 87,850,966 probably benign Het
Rad54b G T 4: 11,599,753 W319L probably damaging Het
Rassf8 T A 6: 145,816,550 L349H probably damaging Het
Rnf113a2 T A 12: 84,417,614 N93K probably benign Het
Sapcd2 C T 2: 25,372,756 A109V probably benign Het
Slamf9 C A 1: 172,476,441 H118N probably benign Het
Slc37a1 A G 17: 31,322,173 Y213C probably damaging Het
Slc5a1 A G 5: 33,159,150 D580G probably benign Het
Slc7a2 T A 8: 40,911,046 I432N probably damaging Het
Tas2r114 A T 6: 131,689,837 L76Q probably damaging Het
Tcerg1 C T 18: 42,535,115 P391L unknown Het
Tdrd12 A C 7: 35,504,157 V314G probably benign Het
Zbtb7b A G 3: 89,380,773 L246S probably benign Het
Other mutations in Myh9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00796:Myh9 APN 15 77796995 splice site probably benign
IGL01105:Myh9 APN 15 77781478 missense probably benign 0.01
IGL01137:Myh9 APN 15 77769542 missense probably benign 0.19
IGL01399:Myh9 APN 15 77767270 missense probably damaging 1.00
IGL01666:Myh9 APN 15 77761931 missense probably benign 0.31
IGL01832:Myh9 APN 15 77791753 missense probably benign 0.02
IGL01933:Myh9 APN 15 77781218 missense probably benign 0.00
IGL02049:Myh9 APN 15 77769870 missense probably benign 0.01
IGL02237:Myh9 APN 15 77786654 missense probably benign 0.03
IGL02243:Myh9 APN 15 77767482 missense probably damaging 1.00
IGL02248:Myh9 APN 15 77786614 missense probably damaging 0.99
IGL02292:Myh9 APN 15 77807996 missense probably damaging 1.00
IGL02315:Myh9 APN 15 77769973 missense probably benign 0.00
IGL02427:Myh9 APN 15 77775804 missense probably damaging 0.98
IGL02675:Myh9 APN 15 77788930 missense possibly damaging 0.89
IGL02727:Myh9 APN 15 77791742 missense probably benign 0.11
IGL02749:Myh9 APN 15 77807986 nonsense probably null
IGL02887:Myh9 APN 15 77796020 nonsense probably null
IGL02926:Myh9 APN 15 77787626 missense probably damaging 1.00
IGL02945:Myh9 APN 15 77762005 missense probably benign 0.05
IGL03137:Myh9 APN 15 77791089 missense probably damaging 1.00
R0784:Myh9 UTSW 15 77777009 splice site probably benign
R1375:Myh9 UTSW 15 77769368 splice site probably null
R1535:Myh9 UTSW 15 77777813 missense probably damaging 0.98
R1563:Myh9 UTSW 15 77771857 missense probably damaging 0.99
R1629:Myh9 UTSW 15 77764401 missense probably damaging 1.00
R1635:Myh9 UTSW 15 77771167 missense probably benign 0.06
R1635:Myh9 UTSW 15 77775899 missense probably benign 0.00
R1693:Myh9 UTSW 15 77812897 missense probably damaging 1.00
R1791:Myh9 UTSW 15 77773264 unclassified probably benign
R2010:Myh9 UTSW 15 77771947 missense probably benign 0.06
R2048:Myh9 UTSW 15 77771132 missense possibly damaging 0.70
R2078:Myh9 UTSW 15 77763912 missense probably benign 0.16
R2092:Myh9 UTSW 15 77764350 nonsense probably null
R2376:Myh9 UTSW 15 77783417 missense probably benign 0.18
R2922:Myh9 UTSW 15 77813184 missense probably damaging 1.00
R3709:Myh9 UTSW 15 77773347 missense possibly damaging 0.84
R3710:Myh9 UTSW 15 77773347 missense possibly damaging 0.84
R3737:Myh9 UTSW 15 77766812 missense probably damaging 0.99
R3738:Myh9 UTSW 15 77766812 missense probably damaging 0.99
R3739:Myh9 UTSW 15 77766812 missense probably damaging 0.99
R4299:Myh9 UTSW 15 77769964 missense probably benign
R4384:Myh9 UTSW 15 77791712 splice site probably benign
R4514:Myh9 UTSW 15 77764000 missense probably benign
R4631:Myh9 UTSW 15 77797028 missense probably damaging 0.99
R4642:Myh9 UTSW 15 77761951 missense probably benign 0.10
R4695:Myh9 UTSW 15 77768853 missense probably damaging 0.99
R4709:Myh9 UTSW 15 77787517 missense probably damaging 1.00
R4766:Myh9 UTSW 15 77807877 missense probably damaging 0.97
R4842:Myh9 UTSW 15 77769253 missense probably damaging 0.99
R4946:Myh9 UTSW 15 77773340 missense probably damaging 1.00
R5030:Myh9 UTSW 15 77807798 intron probably benign
R5055:Myh9 UTSW 15 77764523 missense probably benign 0.12
R5202:Myh9 UTSW 15 77781110 critical splice donor site probably null
R5413:Myh9 UTSW 15 77807986 nonsense probably null
R5435:Myh9 UTSW 15 77769609 missense probably benign 0.00
R5701:Myh9 UTSW 15 77791764 missense probably benign 0.00
R5757:Myh9 UTSW 15 77771162 missense probably benign 0.44
R5793:Myh9 UTSW 15 77768877 missense probably benign 0.23
R5952:Myh9 UTSW 15 77773332 missense possibly damaging 0.65
R6248:Myh9 UTSW 15 77785222 nonsense probably null
R6648:Myh9 UTSW 15 77766772 missense probably benign 0.08
R7055:Myh9 UTSW 15 77775198 missense probably damaging 1.00
R7106:Myh9 UTSW 15 77775121 missense probably benign
R7180:Myh9 UTSW 15 77807910 missense probably benign 0.00
R7205:Myh9 UTSW 15 77783472 missense probably benign 0.08
R7254:Myh9 UTSW 15 77765824 missense probably damaging 1.00
R7284:Myh9 UTSW 15 77787596 missense probably damaging 1.00
R7417:Myh9 UTSW 15 77763865 nonsense probably null
R7695:Myh9 UTSW 15 77766736 missense probably benign 0.31
R7750:Myh9 UTSW 15 77783410 missense probably benign 0.01
R7854:Myh9 UTSW 15 77791753 missense probably benign 0.02
R8220:Myh9 UTSW 15 77764547 missense possibly damaging 0.87
R8324:Myh9 UTSW 15 77788917 critical splice donor site probably null
Z1088:Myh9 UTSW 15 77775258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGAGCGCTAGTCAACAATTC -3'
(R):5'- TATGGCTAGCTTCAGTGACTGC -3'

Sequencing Primer
(F):5'- ATTCCCACACAGCGGGCAG -3'
(R):5'- CTAGCTTCAGTGACTGCGTTTGC -3'
Posted On2016-03-01