Mutagenetix > Incidental Mutation

Incidental Mutation 'R4826:Pla2g6'

374164

Institutional Source

Beutler Lab

Gene Symbol

Pla2g6

Ensembl Gene

ENSMUSG00000042632

Gene Name

phospholipase A2, group VI

Synonyms

iPLA2beta, iPLA2

MMRRC Submission

042442-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4826 (G1)

Quality Score

199

Status

Validated

Chromosome

Chromosomal Location

79286228-79328390 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 79308679 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 263 (S263P)

Ref Sequence

ENSEMBL: ENSMUSP00000134672 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047816] [ENSMUST00000166977] [ENSMUST00000172403] [ENSMUST00000173109] [ENSMUST00000173163] [ENSMUST00000173632] [ENSMUST00000174021]

AlphaFold

P97819

Predicted Effect

possibly damaging
Transcript: ENSMUST00000047816
AA Change: S263P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000044234
Gene: ENSMUSG00000042632
AA Change: S263P

Domain	Start	End	E-Value	Type
low complexity region	96	109	N/A	INTRINSIC
ANK	151	181	2.97e-3	SMART
ANK	185	215	4.6e0	SMART
ANK	219	248	3.23e-4	SMART
ANK	286	312	1.52e0	SMART
ANK	316	345	6.46e-4	SMART
ANK	349	378	2.02e-5	SMART
Pfam:Patatin	427	611	6.7e-21	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166977
AA Change: S263P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000132071
Gene: ENSMUSG00000042632
AA Change: S263P

Domain	Start	End	E-Value	Type
low complexity region	96	109	N/A	INTRINSIC
ANK	151	181	2.97e-3	SMART
ANK	185	215	4.6e0	SMART
ANK	219	248	3.23e-4	SMART
ANK	286	312	1.52e0	SMART
ANK	316	345	6.46e-4	SMART
ANK	349	378	2.02e-5	SMART
Pfam:Patatin	427	611	6.7e-21	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000172403
AA Change: S263P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000131081
Gene: ENSMUSG00000042632
AA Change: S263P

Domain	Start	End	E-Value	Type
low complexity region	96	109	N/A	INTRINSIC
ANK	151	181	2.97e-3	SMART
ANK	185	215	4.6e0	SMART
ANK	219	248	3.23e-4	SMART
ANK	286	312	1.52e0	SMART
ANK	316	345	6.46e-4	SMART
ANK	349	378	2.02e-5	SMART
Pfam:Patatin	427	611	6.7e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000173109

SMART Domains

Protein: ENSMUSP00000133554
Gene: ENSMUSG00000042632

Domain	Start	End	E-Value	Type
low complexity region	96	109	N/A	INTRINSIC
ANK	151	181	2.97e-3	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000173163
AA Change: S263P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000134456
Gene: ENSMUSG00000042632
AA Change: S263P

Domain	Start	End	E-Value	Type
low complexity region	96	109	N/A	INTRINSIC
ANK	151	181	2.97e-3	SMART
ANK	185	215	4.6e0	SMART
ANK	219	248	3.23e-4	SMART
ANK	286	312	1.52e0	SMART
ANK	316	345	6.46e-4	SMART
ANK	349	378	2.02e-5	SMART
Pfam:Patatin	427	611	6.7e-21	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173412

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173601

Predicted Effect

probably benign
Transcript: ENSMUST00000173632

SMART Domains

Protein: ENSMUSP00000133998
Gene: ENSMUSG00000042632

Domain	Start	End	E-Value	Type
low complexity region	96	109	N/A	INTRINSIC
ANK	151	181	2.97e-3	SMART
Blast:ANK	185	204	7e-6	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000174021
AA Change: S263P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000134672
Gene: ENSMUSG00000042632
AA Change: S263P

Domain	Start	End	E-Value	Type
low complexity region	96	109	N/A	INTRINSIC
ANK	151	181	2.97e-3	SMART
ANK	185	215	4.6e0	SMART
ANK	219	248	3.23e-4	SMART
ANK	286	312	1.52e0	SMART
ANK	316	345	6.46e-4	SMART
ANK	349	378	2.02e-5	SMART
Blast:ANK	382	411	2e-8	BLAST
Pfam:Patatin	482	666	2.9e-18	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174089

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174375

Meta Mutation Damage Score

0.3714

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an A2 phospholipase, a class of enzyme that catalyzes the release of fatty acids from phospholipids. The encoded protein may play a role in phospholipid remodelling, arachidonic acid release, leukotriene and prostaglandin synthesis, fas-mediated apoptosis, and transmembrane ion flux in glucose-stimulated B-cells. Several transcript variants encoding multiple isoforms have been described, but the full-length nature of only three of them have been determined to date. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous null mice display impaired male fertility and asthenozoospermia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110002H16Rik	G	T	18: 12,185,779		probably benign	Het
Abca14	A	T	7: 120,216,247	R239S	probably damaging	Het
Acin1	A	G	14: 54,664,617	S573P	probably damaging	Het
Acta2	A	T	19: 34,251,823	Y55*	probably null	Het
Aifm2	T	C	10: 61,725,989	M38T	probably benign	Het
Ank2	C	A	3: 126,956,001	V460L	probably benign	Het
Ap1b1	T	C	11: 5,018,043	S185P	probably benign	Het
Arsj	A	G	3: 126,438,802	Y399C	probably damaging	Het
Clec2d	T	C	6: 129,184,159	V73A	probably benign	Het
Cntln	T	G	4: 85,005,044	M582R	probably benign	Het
Cyp4a10	C	T	4: 115,518,344	P8L	probably benign	Het
Dip2b	A	G	15: 100,169,281	N555D	probably damaging	Het
Dusp4	T	A	8: 34,818,517	F311I	probably damaging	Het
Eif4g3	T	C	4: 138,177,945	V1245A	possibly damaging	Het
Ephb3	G	A	16: 21,214,995	R23H	possibly damaging	Het
Ext2	T	C	2: 93,762,630	T410A	probably benign	Het
Fam193a	A	G	5: 34,436,531	E124G	probably damaging	Het
Fat4	T	A	3: 38,982,957	V3586E	probably damaging	Het
Frmd4a	T	C	2: 4,601,297	S611P	probably damaging	Het
Gcn1l1	A	G	5: 115,593,693	T956A	probably benign	Het
Gm10549	C	A	18: 33,470,785	T107K	unknown	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Herc6	T	A	6: 57,647,087	M614K	probably benign	Het
Hspg2	T	C	4: 137,565,395	C4095R	probably damaging	Het
Hyal5	T	C	6: 24,891,576	I463T	possibly damaging	Het
Icam5	C	T	9: 21,037,803	A817V	possibly damaging	Het
Igf2r	A	T	17: 12,701,353	D1366E	probably damaging	Het
Ints7	G	A	1: 191,611,906	V553I	probably damaging	Het
Iqgap2	T	A	13: 95,763,275	I92F	probably damaging	Het
Itgb1	T	A	8: 128,720,308	C435S	probably damaging	Het
Lrrc71	T	C	3: 87,743,308	M216V	probably benign	Het
Mgam	T	C	6: 40,680,648	V979A	possibly damaging	Het
Myh9	A	T	15: 77,788,946	Y400*	probably null	Het
Narfl	A	G	17: 25,780,332	H240R	probably damaging	Het
Nbeal1	A	G	1: 60,251,342	R1033G	possibly damaging	Het
Nit1	T	C	1: 171,345,598		probably benign	Het
Nlrp1c-ps	A	G	11: 71,242,517		noncoding transcript	Het
Nt5c1a	T	C	4: 123,208,572	V97A	probably damaging	Het
Olfr1154	T	A	2: 87,903,349	D109V	probably damaging	Het
Olfr358	A	G	2: 37,005,333	Y94H	probably damaging	Het
Olfr43	A	G	11: 74,206,331	M295T	possibly damaging	Het
Olfr46	T	A	7: 140,610,319	M51K	probably benign	Het
Olfr683	G	T	7: 105,143,968	N108K	probably damaging	Het
Pde4a	T	A	9: 21,192,380		probably null	Het
Pkn2	T	C	3: 142,809,509	K640R	probably damaging	Het
Prkg1	A	G	19: 31,764,606	S73P	possibly damaging	Het
Prr27	A	C	5: 87,850,966		probably benign	Het
Rad54b	G	T	4: 11,599,753	W319L	probably damaging	Het
Rassf8	T	A	6: 145,816,550	L349H	probably damaging	Het
Rnf113a2	T	A	12: 84,417,614	N93K	probably benign	Het
Sapcd2	C	T	2: 25,372,756	A109V	probably benign	Het
Slamf9	C	A	1: 172,476,441	H118N	probably benign	Het
Slc37a1	A	G	17: 31,322,173	Y213C	probably damaging	Het
Slc5a1	A	G	5: 33,159,150	D580G	probably benign	Het
Slc7a2	T	A	8: 40,911,046	I432N	probably damaging	Het
Tas2r114	A	T	6: 131,689,837	L76Q	probably damaging	Het
Tcerg1	C	T	18: 42,535,115	P391L	unknown	Het
Tdrd12	A	C	7: 35,504,157	V314G	probably benign	Het
Zbtb7b	A	G	3: 89,380,773	L246S	probably benign	Het

Other mutations in Pla2g6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Pla2g6	APN	15	79289241	missense	probably damaging	0.96
IGL00906:Pla2g6	APN	15	79287747	missense	probably damaging	1.00
IGL01432:Pla2g6	APN	15	79317968	start codon destroyed	probably null	1.00
IGL01640:Pla2g6	APN	15	79304313	missense	probably benign
IGL01715:Pla2g6	APN	15	79317857	missense	probably benign	0.00
IGL01943:Pla2g6	APN	15	79313116	missense	probably null	0.00
IGL02551:Pla2g6	APN	15	79299094	missense	possibly damaging	0.95
IGL03120:Pla2g6	APN	15	79286860	missense	probably damaging	1.00
IGL03193:Pla2g6	APN	15	79317785	missense	probably damaging	0.98
IGL03194:Pla2g6	APN	15	79317785	missense	probably damaging	0.98
IGL03205:Pla2g6	APN	15	79317785	missense	probably damaging	0.98
IGL03289:Pla2g6	APN	15	79317785	missense	probably damaging	0.98
R0288:Pla2g6	UTSW	15	79286906	splice site	probably benign
R0631:Pla2g6	UTSW	15	79306396	missense	probably damaging	1.00
R1216:Pla2g6	UTSW	15	79306435	missense	probably benign	0.18
R1617:Pla2g6	UTSW	15	79289141	missense	probably benign	0.03
R1785:Pla2g6	UTSW	15	79306345	missense	probably benign	0.02
R2025:Pla2g6	UTSW	15	79286764	missense	probably damaging	1.00
R2079:Pla2g6	UTSW	15	79312994	missense	probably damaging	1.00
R3952:Pla2g6	UTSW	15	79313096	missense	probably damaging	1.00
R4774:Pla2g6	UTSW	15	79287618	missense	probably damaging	1.00
R5093:Pla2g6	UTSW	15	79287128	missense	probably benign	0.12
R5327:Pla2g6	UTSW	15	79302637	missense	probably benign	0.03
R5390:Pla2g6	UTSW	15	79289693	missense	possibly damaging	0.72
R5419:Pla2g6	UTSW	15	79299142	missense	possibly damaging	0.82
R5432:Pla2g6	UTSW	15	79302617	critical splice donor site	probably null
R5633:Pla2g6	UTSW	15	79299142	missense	possibly damaging	0.82
R5829:Pla2g6	UTSW	15	79287693	missense	possibly damaging	0.73
R5930:Pla2g6	UTSW	15	79303528	intron	probably benign
R6228:Pla2g6	UTSW	15	79305724	missense	probably benign	0.00
R6241:Pla2g6	UTSW	15	79304392	missense	probably benign	0.02
R6339:Pla2g6	UTSW	15	79308816	missense	probably damaging	0.99
R6485:Pla2g6	UTSW	15	79307372	missense	probably benign	0.00
R6754:Pla2g6	UTSW	15	79306310	missense	probably benign	0.01
R7419:Pla2g6	UTSW	15	79305698	splice site	probably null
R7425:Pla2g6	UTSW	15	79308733	missense	probably damaging	1.00
R7710:Pla2g6	UTSW	15	79287158	missense	probably damaging	0.98
R7738:Pla2g6	UTSW	15	79297433	nonsense	probably null
R7768:Pla2g6	UTSW	15	79297314	missense	probably damaging	1.00
R7796:Pla2g6	UTSW	15	79317825	missense	probably benign	0.32
R8184:Pla2g6	UTSW	15	79287122	missense	probably benign	0.02
R8359:Pla2g6	UTSW	15	79287170	missense	probably damaging	0.98
R9105:Pla2g6	UTSW	15	79299197	critical splice acceptor site	probably null
R9280:Pla2g6	UTSW	15	79313114	missense	probably benign	0.09
R9471:Pla2g6	UTSW	15	79317839	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CAAAACTCTAAAGGGTCTGTTCTTCG -3'
(R):5'- AGCGGCCAGTGCTTATCATG -3'

Sequencing Primer
(F):5'- CTAAAGGGTCTGTTCTTCGCACAG -3'
(R):5'- CTGTCAGCTCCTAGGGAAGAAC -3'

Posted On

2016-03-01