Incidental Mutation 'R4826:Igf2r'
ID374166
Institutional Source Beutler Lab
Gene Symbol Igf2r
Ensembl Gene ENSMUSG00000023830
Gene Nameinsulin-like growth factor 2 receptor
SynonymsM6P/IGF2R, IGF-II/CI-MPR, Mpr300, CI-MPR, CD222, mannose-6-phosphate receptor, cation independent
MMRRC Submission 042442-MU
Accession Numbers

Genbank: NM_010515.2; Ensembl: ENSMUST00000024599, ENSMUST00000162982, ENSMUST00000159127

Is this an essential gene? Probably essential (E-score: 0.905) question?
Stock #R4826 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location12682406-12769664 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12701353 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1366 (D1366E)
Ref Sequence ENSEMBL: ENSMUSP00000024599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024599]
Predicted Effect probably damaging
Transcript: ENSMUST00000024599
AA Change: D1366E

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000024599
Gene: ENSMUSG00000023830
AA Change: D1366E

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
low complexity region 94 104 N/A INTRINSIC
Pfam:CIMR 118 266 5.1e-21 PFAM
Pfam:CIMR 272 416 8.8e-22 PFAM
Pfam:CIMR 418 567 3.4e-53 PFAM
Pfam:CIMR 569 709 6.5e-47 PFAM
Pfam:CIMR 713 869 6.5e-34 PFAM
Pfam:CIMR 876 1020 1.9e-10 PFAM
Pfam:CIMR 1024 1171 1e-60 PFAM
Pfam:CIMR 1172 1313 1.2e-17 PFAM
Pfam:CIMR 1315 1455 2.1e-58 PFAM
Pfam:CIMR 1458 1592 1.8e-22 PFAM
Pfam:CIMR 1596 1743 9.1e-23 PFAM
Pfam:CIMR 1748 1887 2.5e-22 PFAM
FN2 1889 1935 9.51e-26 SMART
Pfam:CIMR 1939 2076 2.1e-22 PFAM
Pfam:CIMR 2230 2294 4.9e-9 PFAM
transmembrane domain 2295 2317 N/A INTRINSIC
low complexity region 2336 2363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161738
SMART Domains Protein: ENSMUSP00000124664
Gene: ENSMUSG00000023830

DomainStartEndE-ValueType
Pfam:CIMR 1 65 3.1e-24 PFAM
Pfam:CIMR 68 129 6.1e-15 PFAM
Meta Mutation Damage Score 0.7019 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutants inheriting maternally a targeted disruption of this gene exhibit elevated serum and tissue IGF-II levels, overgrowth, organomegaly, kinky tail, polydactyly, heart defects, edema, dyspnea, imperforate vagina, reduced fertility and perinatal death.Survival is influenced by genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(6)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik G T 18: 12,185,779 probably benign Het
Abca14 A T 7: 120,216,247 R239S probably damaging Het
Acin1 A G 14: 54,664,617 S573P probably damaging Het
Acta2 A T 19: 34,251,823 Y55* probably null Het
Aifm2 T C 10: 61,725,989 M38T probably benign Het
Ank2 C A 3: 126,956,001 V460L probably benign Het
Ap1b1 T C 11: 5,018,043 S185P probably benign Het
Arsj A G 3: 126,438,802 Y399C probably damaging Het
Clec2d T C 6: 129,184,159 V73A probably benign Het
Cntln T G 4: 85,005,044 M582R probably benign Het
Cyp4a10 C T 4: 115,518,344 P8L probably benign Het
Dip2b A G 15: 100,169,281 N555D probably damaging Het
Dusp4 T A 8: 34,818,517 F311I probably damaging Het
Eif4g3 T C 4: 138,177,945 V1245A possibly damaging Het
Ephb3 G A 16: 21,214,995 R23H possibly damaging Het
Ext2 T C 2: 93,762,630 T410A probably benign Het
Fam193a A G 5: 34,436,531 E124G probably damaging Het
Fat4 T A 3: 38,982,957 V3586E probably damaging Het
Frmd4a T C 2: 4,601,297 S611P probably damaging Het
Gcn1l1 A G 5: 115,593,693 T956A probably benign Het
Gm10549 C A 18: 33,470,785 T107K unknown Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Herc6 T A 6: 57,647,087 M614K probably benign Het
Hspg2 T C 4: 137,565,395 C4095R probably damaging Het
Hyal5 T C 6: 24,891,576 I463T possibly damaging Het
Icam5 C T 9: 21,037,803 A817V possibly damaging Het
Ints7 G A 1: 191,611,906 V553I probably damaging Het
Iqgap2 T A 13: 95,763,275 I92F probably damaging Het
Itgb1 T A 8: 128,720,308 C435S probably damaging Het
Lrrc71 T C 3: 87,743,308 M216V probably benign Het
Mgam T C 6: 40,680,648 V979A possibly damaging Het
Myh9 A T 15: 77,788,946 Y400* probably null Het
Narfl A G 17: 25,780,332 H240R probably damaging Het
Nbeal1 A G 1: 60,251,342 R1033G possibly damaging Het
Nit1 T C 1: 171,345,598 probably benign Het
Nlrp1c-ps A G 11: 71,242,517 noncoding transcript Het
Nt5c1a T C 4: 123,208,572 V97A probably damaging Het
Olfr1154 T A 2: 87,903,349 D109V probably damaging Het
Olfr358 A G 2: 37,005,333 Y94H probably damaging Het
Olfr43 A G 11: 74,206,331 M295T possibly damaging Het
Olfr46 T A 7: 140,610,319 M51K probably benign Het
Olfr683 G T 7: 105,143,968 N108K probably damaging Het
Pde4a T A 9: 21,192,380 probably null Het
Pkn2 T C 3: 142,809,509 K640R probably damaging Het
Pla2g6 A G 15: 79,308,679 S263P possibly damaging Het
Prkg1 A G 19: 31,764,606 S73P possibly damaging Het
Prr27 A C 5: 87,850,966 probably benign Het
Rad54b G T 4: 11,599,753 W319L probably damaging Het
Rassf8 T A 6: 145,816,550 L349H probably damaging Het
Rnf113a2 T A 12: 84,417,614 N93K probably benign Het
Sapcd2 C T 2: 25,372,756 A109V probably benign Het
Slamf9 C A 1: 172,476,441 H118N probably benign Het
Slc37a1 A G 17: 31,322,173 Y213C probably damaging Het
Slc5a1 A G 5: 33,159,150 D580G probably benign Het
Slc7a2 T A 8: 40,911,046 I432N probably damaging Het
Tas2r114 A T 6: 131,689,837 L76Q probably damaging Het
Tcerg1 C T 18: 42,535,115 P391L unknown Het
Tdrd12 A C 7: 35,504,157 V314G probably benign Het
Zbtb7b A G 3: 89,380,773 L246S probably benign Het
Other mutations in Igf2r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Igf2r APN 17 12713990 missense probably benign 0.01
IGL00534:Igf2r APN 17 12739328 missense probably damaging 0.97
IGL00902:Igf2r APN 17 12700358 missense probably damaging 0.99
IGL00903:Igf2r APN 17 12683867 missense possibly damaging 0.70
IGL01160:Igf2r APN 17 12704775 missense possibly damaging 0.73
IGL01380:Igf2r APN 17 12695374 missense probably benign 0.01
IGL01392:Igf2r APN 17 12704349 missense probably benign
IGL01557:Igf2r APN 17 12704635 missense possibly damaging 0.82
IGL01568:Igf2r APN 17 12683985 missense possibly damaging 0.93
IGL01611:Igf2r APN 17 12725415 nonsense probably null
IGL01720:Igf2r APN 17 12701313 missense probably damaging 0.99
IGL01756:Igf2r APN 17 12683822 missense probably benign
IGL01839:Igf2r APN 17 12705022 missense probably damaging 1.00
IGL01904:Igf2r APN 17 12714911 missense probably damaging 0.99
IGL01965:Igf2r APN 17 12704338 missense probably benign 0.12
IGL02083:Igf2r APN 17 12693192 nonsense probably null
IGL02095:Igf2r APN 17 12702005 missense probably damaging 0.99
IGL02183:Igf2r APN 17 12698516 unclassified probably benign
IGL02576:Igf2r APN 17 12748763 missense possibly damaging 0.90
IGL02649:Igf2r APN 17 12712087 missense possibly damaging 0.93
IGL02807:Igf2r APN 17 12719883 missense probably damaging 0.98
IGL02833:Igf2r APN 17 12692723 missense probably damaging 0.97
IGL02885:Igf2r APN 17 12694120 missense possibly damaging 0.94
IGL02990:Igf2r APN 17 12710746 splice site probably benign
IGL03080:Igf2r APN 17 12726676 missense probably benign 0.06
IGL03176:Igf2r APN 17 12716672 missense probably damaging 1.00
NA:Igf2r UTSW 17 12691962 missense probably benign
R0165:Igf2r UTSW 17 12698527 missense probably benign 0.07
R0412:Igf2r UTSW 17 12683948 missense probably damaging 0.98
R0523:Igf2r UTSW 17 12692064 missense probably benign 0.27
R0631:Igf2r UTSW 17 12717274 splice site probably null
R0722:Igf2r UTSW 17 12715495 critical splice acceptor site probably null
R0894:Igf2r UTSW 17 12692101 missense probably benign 0.02
R1265:Igf2r UTSW 17 12694124 missense probably damaging 0.98
R1466:Igf2r UTSW 17 12717269 splice site probably benign
R1485:Igf2r UTSW 17 12691285 missense probably damaging 1.00
R1633:Igf2r UTSW 17 12726309 missense probably benign
R1693:Igf2r UTSW 17 12704316 missense probably damaging 0.97
R1751:Igf2r UTSW 17 12697441 missense possibly damaging 0.94
R1843:Igf2r UTSW 17 12704270 critical splice donor site probably null
R1981:Igf2r UTSW 17 12733903 nonsense probably null
R1994:Igf2r UTSW 17 12692738 missense probably benign
R2060:Igf2r UTSW 17 12701319 missense possibly damaging 0.92
R2108:Igf2r UTSW 17 12698251 missense probably benign 0.02
R2132:Igf2r UTSW 17 12722208 missense probably benign 0.12
R2314:Igf2r UTSW 17 12715943 missense probably benign 0.28
R2349:Igf2r UTSW 17 12722311 splice site probably null
R2696:Igf2r UTSW 17 12695344 missense possibly damaging 0.96
R2864:Igf2r UTSW 17 12686724 missense probably damaging 0.99
R2865:Igf2r UTSW 17 12686724 missense probably damaging 0.99
R3884:Igf2r UTSW 17 12709468 missense probably benign
R3930:Igf2r UTSW 17 12705829 missense probably benign 0.01
R4021:Igf2r UTSW 17 12748751 missense probably damaging 0.97
R4125:Igf2r UTSW 17 12702254 missense possibly damaging 0.93
R4342:Igf2r UTSW 17 12709511 missense possibly damaging 0.95
R4343:Igf2r UTSW 17 12709511 missense possibly damaging 0.95
R4345:Igf2r UTSW 17 12709511 missense possibly damaging 0.95
R4760:Igf2r UTSW 17 12703465 missense possibly damaging 0.92
R4796:Igf2r UTSW 17 12684126 missense possibly damaging 0.70
R4816:Igf2r UTSW 17 12684097 missense probably damaging 0.96
R4933:Igf2r UTSW 17 12691877 splice site probably null
R4980:Igf2r UTSW 17 12703360 critical splice donor site probably null
R5389:Igf2r UTSW 17 12725416 missense probably damaging 1.00
R5473:Igf2r UTSW 17 12695314 missense probably benign 0.20
R5494:Igf2r UTSW 17 12693145 missense possibly damaging 0.74
R5619:Igf2r UTSW 17 12739334 missense probably damaging 1.00
R5738:Igf2r UTSW 17 12717367 missense probably benign 0.23
R5761:Igf2r UTSW 17 12698352 splice site probably null
R5794:Igf2r UTSW 17 12709445 missense probably benign 0.37
R6210:Igf2r UTSW 17 12714951 missense probably damaging 0.98
R6319:Igf2r UTSW 17 12714113 missense probably damaging 1.00
R6388:Igf2r UTSW 17 12683900 missense probably benign
R6396:Igf2r UTSW 17 12714090 missense probably benign 0.00
R6584:Igf2r UTSW 17 12701250 missense probably damaging 0.99
R6590:Igf2r UTSW 17 12691937 nonsense probably null
R6591:Igf2r UTSW 17 12689008 missense probably damaging 1.00
R6599:Igf2r UTSW 17 12698618 missense possibly damaging 0.85
R6690:Igf2r UTSW 17 12691937 nonsense probably null
R6691:Igf2r UTSW 17 12689008 missense probably damaging 1.00
R6752:Igf2r UTSW 17 12714944 missense probably damaging 1.00
R6816:Igf2r UTSW 17 12714082 missense probably damaging 0.99
R6841:Igf2r UTSW 17 12703376 missense probably damaging 0.97
R6877:Igf2r UTSW 17 12697341 missense probably damaging 0.97
R6950:Igf2r UTSW 17 12718718 missense probably benign
R7030:Igf2r UTSW 17 12733866 missense probably damaging 1.00
R7038:Igf2r UTSW 17 12698325 missense probably benign 0.23
R7055:Igf2r UTSW 17 12704323 missense probably damaging 0.99
R7074:Igf2r UTSW 17 12714116 missense possibly damaging 0.57
R7348:Igf2r UTSW 17 12703484 missense probably damaging 0.99
R7413:Igf2r UTSW 17 12698228 nonsense probably null
R7463:Igf2r UTSW 17 12710645 missense probably benign 0.16
R7619:Igf2r UTSW 17 12698273 missense possibly damaging 0.88
R7730:Igf2r UTSW 17 12735991 missense probably damaging 0.98
R7733:Igf2r UTSW 17 12739369 missense possibly damaging 0.90
R7881:Igf2r UTSW 17 12748704 missense probably benign
R8022:Igf2r UTSW 17 12718795 missense probably damaging 1.00
R8138:Igf2r UTSW 17 12701238 missense probably benign 0.32
R8220:Igf2r UTSW 17 12692071 missense probably benign 0.22
R8305:Igf2r UTSW 17 12733860 missense probably benign
R8359:Igf2r UTSW 17 12683861 missense probably benign
R8510:Igf2r UTSW 17 12704313 missense probably benign 0.38
X0028:Igf2r UTSW 17 12704913 nonsense probably null
Z1177:Igf2r UTSW 17 12697399 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAACTCCTTCCACTGAGGCCTC -3'
(R):5'- GGACTCATCAAAGCTCAAGGC -3'

Sequencing Primer
(F):5'- GCTCTGTCTGTCCCAGAAGAC -3'
(R):5'- GGCTGTGCCTTGCTCAC -3'
Posted On2016-03-01