Mutagenetix > Incidental Mutation

Incidental Mutation 'R4826:Igf2r'

374166

Institutional Source

Beutler Lab

Gene Symbol

Igf2r

Ensembl Gene

ENSMUSG00000023830

Gene Name

insulin-like growth factor 2 receptor

Synonyms

IGF-II/CI-MPR, CD222, mannose-6-phosphate receptor, cation independent, M6P/IGF2R, Mpr300, CI-MPR

MMRRC Submission

042442-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.921) question?

Stock #

R4826 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

12901293-12988551 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 12920240 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1366 (D1366E)

Ref Sequence

ENSEMBL: ENSMUSP00000024599 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024599]

AlphaFold

Q07113

Predicted Effect

probably damaging
Transcript: ENSMUST00000024599
AA Change: D1366E

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000024599
Gene: ENSMUSG00000023830
AA Change: D1366E

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
low complexity region	94	104	N/A	INTRINSIC
Pfam:CIMR	118	266	5.1e-21	PFAM
Pfam:CIMR	272	416	8.8e-22	PFAM
Pfam:CIMR	418	567	3.4e-53	PFAM
Pfam:CIMR	569	709	6.5e-47	PFAM
Pfam:CIMR	713	869	6.5e-34	PFAM
Pfam:CIMR	876	1020	1.9e-10	PFAM
Pfam:CIMR	1024	1171	1e-60	PFAM
Pfam:CIMR	1172	1313	1.2e-17	PFAM
Pfam:CIMR	1315	1455	2.1e-58	PFAM
Pfam:CIMR	1458	1592	1.8e-22	PFAM
Pfam:CIMR	1596	1743	9.1e-23	PFAM
Pfam:CIMR	1748	1887	2.5e-22	PFAM
FN2	1889	1935	9.51e-26	SMART
Pfam:CIMR	1939	2076	2.1e-22	PFAM
Pfam:CIMR	2230	2294	4.9e-9	PFAM
transmembrane domain	2295	2317	N/A	INTRINSIC
low complexity region	2336	2363	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161738

SMART Domains

Protein: ENSMUSP00000124664
Gene: ENSMUSG00000023830

Domain	Start	End	E-Value	Type
Pfam:CIMR	1	65	3.1e-24	PFAM
Pfam:CIMR	68	129	6.1e-15	PFAM

Meta Mutation Damage Score

0.7019

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutants inheriting maternally a targeted disruption of this gene exhibit elevated serum and tissue IGF-II levels, overgrowth, organomegaly, kinky tail, polydactyly, heart defects, edema, dyspnea, imperforate vagina, reduced fertility and perinatal death.Survival is influenced by genetic background. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(6)

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	A	T	7: 119,815,470 (GRCm39)	R239S	probably damaging	Het
Acin1	A	G	14: 54,902,074 (GRCm39)	S573P	probably damaging	Het
Acta2	A	T	19: 34,229,223 (GRCm39)	Y55*	probably null	Het
Aifm2	T	C	10: 61,561,768 (GRCm39)	M38T	probably benign	Het
Ank2	C	A	3: 126,749,650 (GRCm39)	V460L	probably benign	Het
Ap1b1	T	C	11: 4,968,043 (GRCm39)	S185P	probably benign	Het
Arsj	A	G	3: 126,232,451 (GRCm39)	Y399C	probably damaging	Het
Ciao3	A	G	17: 25,999,306 (GRCm39)	H240R	probably damaging	Het
Clec2d	T	C	6: 129,161,122 (GRCm39)	V73A	probably benign	Het
Cntln	T	G	4: 84,923,281 (GRCm39)	M582R	probably benign	Het
Cyp4a10	C	T	4: 115,375,541 (GRCm39)	P8L	probably benign	Het
Dip2b	A	G	15: 100,067,162 (GRCm39)	N555D	probably damaging	Het
Dusp4	T	A	8: 35,285,671 (GRCm39)	F311I	probably damaging	Het
Eif4g3	T	C	4: 137,905,256 (GRCm39)	V1245A	possibly damaging	Het
Ephb3	G	A	16: 21,033,745 (GRCm39)	R23H	possibly damaging	Het
Ext2	T	C	2: 93,592,975 (GRCm39)	T410A	probably benign	Het
Fam193a	A	G	5: 34,593,875 (GRCm39)	E124G	probably damaging	Het
Fat4	T	A	3: 39,037,106 (GRCm39)	V3586E	probably damaging	Het
Frmd4a	T	C	2: 4,606,108 (GRCm39)	S611P	probably damaging	Het
Gcn1	A	G	5: 115,731,752 (GRCm39)	T956A	probably benign	Het
Gm10549	C	A	18: 33,603,838 (GRCm39)	T107K	unknown	Het
Herc6	T	A	6: 57,624,072 (GRCm39)	M614K	probably benign	Het
Hspg2	T	C	4: 137,292,706 (GRCm39)	C4095R	probably damaging	Het
Hyal5	T	C	6: 24,891,575 (GRCm39)	I463T	possibly damaging	Het
Icam5	C	T	9: 20,949,099 (GRCm39)	A817V	possibly damaging	Het
Ints7	G	A	1: 191,344,018 (GRCm39)	V553I	probably damaging	Het
Iqgap2	T	A	13: 95,899,783 (GRCm39)	I92F	probably damaging	Het
Itgb1	T	A	8: 129,446,789 (GRCm39)	C435S	probably damaging	Het
Lrrc71	T	C	3: 87,650,615 (GRCm39)	M216V	probably benign	Het
Mgam	T	C	6: 40,657,582 (GRCm39)	V979A	possibly damaging	Het
Mplkipl1	C	T	19: 61,164,364 (GRCm39)	G24R	unknown	Het
Myh9	A	T	15: 77,673,146 (GRCm39)	Y400*	probably null	Het
Nbeal1	A	G	1: 60,290,501 (GRCm39)	R1033G	possibly damaging	Het
Nit1	T	C	1: 171,173,166 (GRCm39)		probably benign	Het
Nlrp1c-ps	A	G	11: 71,133,343 (GRCm39)		noncoding transcript	Het
Nt5c1a	T	C	4: 123,102,365 (GRCm39)	V97A	probably damaging	Het
Or12k5	A	G	2: 36,895,345 (GRCm39)	Y94H	probably damaging	Het
Or13a18	T	A	7: 140,190,232 (GRCm39)	M51K	probably benign	Het
Or1a1b	A	G	11: 74,097,157 (GRCm39)	M295T	possibly damaging	Het
Or56a5	G	T	7: 104,793,175 (GRCm39)	N108K	probably damaging	Het
Or9m1	T	A	2: 87,733,693 (GRCm39)	D109V	probably damaging	Het
Pde4a	T	A	9: 21,103,676 (GRCm39)		probably null	Het
Pkn2	T	C	3: 142,515,270 (GRCm39)	K640R	probably damaging	Het
Pla2g6	A	G	15: 79,192,879 (GRCm39)	S263P	possibly damaging	Het
Prkg1	A	G	19: 31,742,006 (GRCm39)	S73P	possibly damaging	Het
Prr27	A	C	5: 87,998,825 (GRCm39)		probably benign	Het
Rad54b	G	T	4: 11,599,753 (GRCm39)	W319L	probably damaging	Het
Rassf8	T	A	6: 145,762,276 (GRCm39)	L349H	probably damaging	Het
Rmc1	G	T	18: 12,318,836 (GRCm39)		probably benign	Het
Rnf113a2	T	A	12: 84,464,388 (GRCm39)	N93K	probably benign	Het
Sapcd2	C	T	2: 25,262,768 (GRCm39)	A109V	probably benign	Het
Slamf9	C	A	1: 172,304,008 (GRCm39)	H118N	probably benign	Het
Slc37a1	A	G	17: 31,541,147 (GRCm39)	Y213C	probably damaging	Het
Slc5a1	A	G	5: 33,316,494 (GRCm39)	D580G	probably benign	Het
Slc7a2	T	A	8: 41,364,083 (GRCm39)	I432N	probably damaging	Het
Tas2r114	A	T	6: 131,666,800 (GRCm39)	L76Q	probably damaging	Het
Tcerg1	C	T	18: 42,668,180 (GRCm39)	P391L	unknown	Het
Tdrd12	A	C	7: 35,203,582 (GRCm39)	V314G	probably benign	Het
Zbtb7b	A	G	3: 89,288,080 (GRCm39)	L246S	probably benign	Het

Other mutations in Igf2r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Igf2r	APN	17	12,932,877 (GRCm39)	missense	probably benign	0.01
IGL00534:Igf2r	APN	17	12,958,215 (GRCm39)	missense	probably damaging	0.97
IGL00902:Igf2r	APN	17	12,919,245 (GRCm39)	missense	probably damaging	0.99
IGL00903:Igf2r	APN	17	12,902,754 (GRCm39)	missense	possibly damaging	0.70
IGL01160:Igf2r	APN	17	12,923,662 (GRCm39)	missense	possibly damaging	0.73
IGL01380:Igf2r	APN	17	12,914,261 (GRCm39)	missense	probably benign	0.01
IGL01392:Igf2r	APN	17	12,923,236 (GRCm39)	missense	probably benign
IGL01557:Igf2r	APN	17	12,923,522 (GRCm39)	missense	possibly damaging	0.82
IGL01568:Igf2r	APN	17	12,902,872 (GRCm39)	missense	possibly damaging	0.93
IGL01611:Igf2r	APN	17	12,944,302 (GRCm39)	nonsense	probably null
IGL01720:Igf2r	APN	17	12,920,200 (GRCm39)	missense	probably damaging	0.99
IGL01756:Igf2r	APN	17	12,902,709 (GRCm39)	missense	probably benign
IGL01839:Igf2r	APN	17	12,923,909 (GRCm39)	missense	probably damaging	1.00
IGL01904:Igf2r	APN	17	12,933,798 (GRCm39)	missense	probably damaging	0.99
IGL01965:Igf2r	APN	17	12,923,225 (GRCm39)	missense	probably benign	0.12
IGL02083:Igf2r	APN	17	12,912,079 (GRCm39)	nonsense	probably null
IGL02095:Igf2r	APN	17	12,920,892 (GRCm39)	missense	probably damaging	0.99
IGL02183:Igf2r	APN	17	12,917,403 (GRCm39)	unclassified	probably benign
IGL02576:Igf2r	APN	17	12,967,650 (GRCm39)	missense	possibly damaging	0.90
IGL02649:Igf2r	APN	17	12,930,974 (GRCm39)	missense	possibly damaging	0.93
IGL02807:Igf2r	APN	17	12,938,770 (GRCm39)	missense	probably damaging	0.98
IGL02833:Igf2r	APN	17	12,911,610 (GRCm39)	missense	probably damaging	0.97
IGL02885:Igf2r	APN	17	12,913,007 (GRCm39)	missense	possibly damaging	0.94
IGL02990:Igf2r	APN	17	12,929,633 (GRCm39)	splice site	probably benign
IGL03080:Igf2r	APN	17	12,945,563 (GRCm39)	missense	probably benign	0.06
IGL03176:Igf2r	APN	17	12,935,559 (GRCm39)	missense	probably damaging	1.00
blunt	UTSW	17	12,941,062 (GRCm39)	missense	probably benign	0.02
brusque	UTSW	17	12,933,838 (GRCm39)	missense	probably damaging	0.98
gruff	UTSW	17	12,902,984 (GRCm39)	missense	probably damaging	0.96
outlier	UTSW	17	12,914,201 (GRCm39)	missense	probably benign	0.20
NA:Igf2r	UTSW	17	12,910,849 (GRCm39)	missense	probably benign
R0165:Igf2r	UTSW	17	12,917,414 (GRCm39)	missense	probably benign	0.07
R0412:Igf2r	UTSW	17	12,902,835 (GRCm39)	missense	probably damaging	0.98
R0523:Igf2r	UTSW	17	12,910,951 (GRCm39)	missense	probably benign	0.27
R0631:Igf2r	UTSW	17	12,936,161 (GRCm39)	splice site	probably null
R0722:Igf2r	UTSW	17	12,934,382 (GRCm39)	critical splice acceptor site	probably null
R0894:Igf2r	UTSW	17	12,910,988 (GRCm39)	missense	probably benign	0.02
R1265:Igf2r	UTSW	17	12,913,011 (GRCm39)	missense	probably damaging	0.98
R1466:Igf2r	UTSW	17	12,936,156 (GRCm39)	splice site	probably benign
R1485:Igf2r	UTSW	17	12,910,172 (GRCm39)	missense	probably damaging	1.00
R1633:Igf2r	UTSW	17	12,945,196 (GRCm39)	missense	probably benign
R1693:Igf2r	UTSW	17	12,923,203 (GRCm39)	missense	probably damaging	0.97
R1751:Igf2r	UTSW	17	12,916,328 (GRCm39)	missense	possibly damaging	0.94
R1843:Igf2r	UTSW	17	12,923,157 (GRCm39)	critical splice donor site	probably null
R1981:Igf2r	UTSW	17	12,952,790 (GRCm39)	nonsense	probably null
R1994:Igf2r	UTSW	17	12,911,625 (GRCm39)	missense	probably benign
R2060:Igf2r	UTSW	17	12,920,206 (GRCm39)	missense	possibly damaging	0.92
R2108:Igf2r	UTSW	17	12,917,138 (GRCm39)	missense	probably benign	0.02
R2132:Igf2r	UTSW	17	12,941,095 (GRCm39)	missense	probably benign	0.12
R2314:Igf2r	UTSW	17	12,934,830 (GRCm39)	missense	probably benign	0.28
R2349:Igf2r	UTSW	17	12,941,198 (GRCm39)	splice site	probably null
R2696:Igf2r	UTSW	17	12,914,231 (GRCm39)	missense	possibly damaging	0.96
R2864:Igf2r	UTSW	17	12,905,611 (GRCm39)	missense	probably damaging	0.99
R2865:Igf2r	UTSW	17	12,905,611 (GRCm39)	missense	probably damaging	0.99
R3884:Igf2r	UTSW	17	12,928,355 (GRCm39)	missense	probably benign
R3930:Igf2r	UTSW	17	12,924,716 (GRCm39)	missense	probably benign	0.01
R4021:Igf2r	UTSW	17	12,967,638 (GRCm39)	missense	probably damaging	0.97
R4125:Igf2r	UTSW	17	12,921,141 (GRCm39)	missense	possibly damaging	0.93
R4342:Igf2r	UTSW	17	12,928,398 (GRCm39)	missense	possibly damaging	0.95
R4343:Igf2r	UTSW	17	12,928,398 (GRCm39)	missense	possibly damaging	0.95
R4345:Igf2r	UTSW	17	12,928,398 (GRCm39)	missense	possibly damaging	0.95
R4760:Igf2r	UTSW	17	12,922,352 (GRCm39)	missense	possibly damaging	0.92
R4796:Igf2r	UTSW	17	12,903,013 (GRCm39)	missense	possibly damaging	0.70
R4816:Igf2r	UTSW	17	12,902,984 (GRCm39)	missense	probably damaging	0.96
R4933:Igf2r	UTSW	17	12,910,764 (GRCm39)	splice site	probably null
R4980:Igf2r	UTSW	17	12,922,247 (GRCm39)	critical splice donor site	probably null
R5389:Igf2r	UTSW	17	12,944,303 (GRCm39)	missense	probably damaging	1.00
R5473:Igf2r	UTSW	17	12,914,201 (GRCm39)	missense	probably benign	0.20
R5494:Igf2r	UTSW	17	12,912,032 (GRCm39)	missense	possibly damaging	0.74
R5619:Igf2r	UTSW	17	12,958,221 (GRCm39)	missense	probably damaging	1.00
R5738:Igf2r	UTSW	17	12,936,254 (GRCm39)	missense	probably benign	0.23
R5761:Igf2r	UTSW	17	12,917,239 (GRCm39)	splice site	probably null
R5794:Igf2r	UTSW	17	12,928,332 (GRCm39)	missense	probably benign	0.37
R6210:Igf2r	UTSW	17	12,933,838 (GRCm39)	missense	probably damaging	0.98
R6319:Igf2r	UTSW	17	12,933,000 (GRCm39)	missense	probably damaging	1.00
R6388:Igf2r	UTSW	17	12,902,787 (GRCm39)	missense	probably benign
R6396:Igf2r	UTSW	17	12,932,977 (GRCm39)	missense	probably benign	0.00
R6584:Igf2r	UTSW	17	12,920,137 (GRCm39)	missense	probably damaging	0.99
R6590:Igf2r	UTSW	17	12,910,824 (GRCm39)	nonsense	probably null
R6591:Igf2r	UTSW	17	12,907,895 (GRCm39)	missense	probably damaging	1.00
R6599:Igf2r	UTSW	17	12,917,505 (GRCm39)	missense	possibly damaging	0.85
R6690:Igf2r	UTSW	17	12,910,824 (GRCm39)	nonsense	probably null
R6691:Igf2r	UTSW	17	12,907,895 (GRCm39)	missense	probably damaging	1.00
R6752:Igf2r	UTSW	17	12,933,831 (GRCm39)	missense	probably damaging	1.00
R6816:Igf2r	UTSW	17	12,932,969 (GRCm39)	missense	probably damaging	0.99
R6841:Igf2r	UTSW	17	12,922,263 (GRCm39)	missense	probably damaging	0.97
R6877:Igf2r	UTSW	17	12,916,228 (GRCm39)	missense	probably damaging	0.97
R6950:Igf2r	UTSW	17	12,937,605 (GRCm39)	missense	probably benign
R7030:Igf2r	UTSW	17	12,952,753 (GRCm39)	missense	probably damaging	1.00
R7038:Igf2r	UTSW	17	12,917,212 (GRCm39)	missense	probably benign	0.23
R7055:Igf2r	UTSW	17	12,923,210 (GRCm39)	missense	probably damaging	0.99
R7074:Igf2r	UTSW	17	12,933,003 (GRCm39)	missense	possibly damaging	0.57
R7348:Igf2r	UTSW	17	12,922,371 (GRCm39)	missense	probably damaging	0.99
R7413:Igf2r	UTSW	17	12,917,115 (GRCm39)	nonsense	probably null
R7463:Igf2r	UTSW	17	12,929,532 (GRCm39)	missense	probably benign	0.16
R7619:Igf2r	UTSW	17	12,917,160 (GRCm39)	missense	possibly damaging	0.88
R7730:Igf2r	UTSW	17	12,954,878 (GRCm39)	missense	probably damaging	0.98
R7733:Igf2r	UTSW	17	12,958,256 (GRCm39)	missense	possibly damaging	0.90
R7881:Igf2r	UTSW	17	12,967,591 (GRCm39)	missense	probably benign
R8022:Igf2r	UTSW	17	12,937,682 (GRCm39)	missense	probably damaging	1.00
R8138:Igf2r	UTSW	17	12,920,125 (GRCm39)	missense	probably benign	0.32
R8220:Igf2r	UTSW	17	12,910,958 (GRCm39)	missense	probably benign	0.22
R8305:Igf2r	UTSW	17	12,952,747 (GRCm39)	missense	probably benign
R8359:Igf2r	UTSW	17	12,902,748 (GRCm39)	missense	probably benign
R8500:Igf2r	UTSW	17	12,928,328 (GRCm39)	missense	probably damaging	0.99
R8510:Igf2r	UTSW	17	12,923,200 (GRCm39)	missense	probably benign	0.38
R8933:Igf2r	UTSW	17	12,923,524 (GRCm39)	missense	probably damaging	1.00
R8933:Igf2r	UTSW	17	12,920,131 (GRCm39)	missense	probably damaging	0.97
R8976:Igf2r	UTSW	17	12,945,659 (GRCm39)	missense	probably damaging	1.00
R8994:Igf2r	UTSW	17	12,935,537 (GRCm39)	missense	possibly damaging	0.87
R9059:Igf2r	UTSW	17	12,970,180 (GRCm39)	start codon destroyed	probably null
R9097:Igf2r	UTSW	17	12,910,100 (GRCm39)	missense	probably damaging	1.00
R9127:Igf2r	UTSW	17	12,958,238 (GRCm39)	missense	probably damaging	0.98
R9278:Igf2r	UTSW	17	12,914,240 (GRCm39)	missense	probably damaging	1.00
R9362:Igf2r	UTSW	17	12,941,062 (GRCm39)	missense	probably benign	0.02
R9371:Igf2r	UTSW	17	12,924,646 (GRCm39)	missense	possibly damaging	0.93
R9522:Igf2r	UTSW	17	12,917,215 (GRCm39)	missense	probably benign	0.26
R9567:Igf2r	UTSW	17	12,905,641 (GRCm39)	missense	probably damaging	1.00
R9665:Igf2r	UTSW	17	12,913,027 (GRCm39)	missense	probably benign	0.17
R9666:Igf2r	UTSW	17	12,945,588 (GRCm39)	missense	probably benign
X0028:Igf2r	UTSW	17	12,923,800 (GRCm39)	nonsense	probably null
Z1177:Igf2r	UTSW	17	12,916,286 (GRCm39)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AAACTCCTTCCACTGAGGCCTC -3'
(R):5'- GGACTCATCAAAGCTCAAGGC -3'

Sequencing Primer
(F):5'- GCTCTGTCTGTCCCAGAAGAC -3'
(R):5'- GGCTGTGCCTTGCTCAC -3'

Posted On

2016-03-01