Mutagenetix > Incidental Mutations

Incidental Mutation 'R4824:Ror2'

374253

Institutional Source

Beutler Lab

Gene Symbol

Ror2

Ensembl Gene

ENSMUSG00000021464

Gene Name

receptor tyrosine kinase-like orphan receptor 2

Synonyms

Ntrkr2

MMRRC Submission

042440-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4824 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

53109312-53286124 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 53110683 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 791 (Q791L)

Ref Sequence

ENSEMBL: ENSMUSP00000021918 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021918] [ENSMUST00000130235]

Predicted Effect

probably benign
Transcript: ENSMUST00000021918
AA Change: Q791L

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000021918
Gene: ENSMUSG00000021464
AA Change: Q791L

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
IGc2	74	142	5.23e-16	SMART
Pfam:Fz	174	294	1.2e-12	PFAM
KR	314	396	3.94e-45	SMART
transmembrane domain	403	425	N/A	INTRINSIC
TyrKc	473	746	1.96e-113	SMART
low complexity region	765	783	N/A	INTRINSIC
low complexity region	788	801	N/A	INTRINSIC
low complexity region	839	859	N/A	INTRINSIC
low complexity region	860	872	N/A	INTRINSIC
low complexity region	905	924	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000130235
AA Change: Q779L

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000123362
Gene: ENSMUSG00000021464
AA Change: Q779L

Domain	Start	End	E-Value	Type
IGc2	62	130	5.23e-16	SMART
Pfam:Fz	162	289	3.2e-26	PFAM
KR	302	384	3.94e-45	SMART
transmembrane domain	391	413	N/A	INTRINSIC
TyrKc	461	734	1.96e-113	SMART
low complexity region	753	771	N/A	INTRINSIC
low complexity region	776	789	N/A	INTRINSIC
low complexity region	827	847	N/A	INTRINSIC
low complexity region	848	860	N/A	INTRINSIC
low complexity region	893	912	N/A	INTRINSIC

Meta Mutation Damage Score

0.0580

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

98% (123/126)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor protein tyrosine kinase and type I transmembrane protein that belongs to the ROR subfamily of cell surface receptors. The protein may be involved in the early formation of the chondrocytes and may be required for cartilage and growth plate development. Mutations in this gene can cause brachydactyly type B, a skeletal disorder characterized by hypoplasia/aplasia of distal phalanges and nails. In addition, mutations in this gene can cause the autosomal recessive form of Robinow syndrome, which is characterized by skeletal dysplasia with generalized limb bone shortening, segmental defects of the spine, brachydactyly, and a dysmorphic facial appearance. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some disruptions in this gene die within the first few hours after birth. They display respiratory and cardiovascular abnormalities as well as a variety of skeletal defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 107 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,065,676	T209A	probably benign	Het
1700086D15Rik	T	C	11: 65,152,615		probably benign	Het
4930452B06Rik	A	T	14: 8,665,997	M1K	probably null	Het
A130010J15Rik	G	A	1: 193,174,657	V106I	probably benign	Het
Abca16	C	A	7: 120,475,479	N580K	possibly damaging	Het
Actrt2	A	T	4: 154,666,887	F264Y	probably damaging	Het
Adh4	G	A	3: 138,429,046	S327N	possibly damaging	Het
Alkbh5	T	C	11: 60,553,871		probably null	Het
Anapc1	T	A	2: 128,628,690	T1507S	possibly damaging	Het
Anapc2	A	G	2: 25,277,752	R444G	probably damaging	Het
Apoh	G	T	11: 108,414,261	W335L	probably benign	Het
B4galt7	A	T	13: 55,604,349	H71L	possibly damaging	Het
Bicd2	A	G	13: 49,379,012	E358G	probably damaging	Het
Bmper	T	A	9: 23,223,660	V7D	possibly damaging	Het
Brca2	T	C	5: 150,539,735	F988S	probably damaging	Het
Brix1	A	G	15: 10,485,742	V49A	possibly damaging	Het
Brpf3	T	C	17: 28,806,486	S178P	probably benign	Het
Btaf1	A	G	19: 36,981,048	Y655C	possibly damaging	Het
C1rl	C	G	6: 124,509,081	Y470*	probably null	Het
Cacnb4	A	G	2: 52,675,810	V21A	probably benign	Het
Caskin1	C	A	17: 24,501,129	P437T	probably benign	Het
Casz1	C	A	4: 148,944,571	P1158T	probably damaging	Het
Ccdc141	T	A	2: 77,124,336	Q189L	probably damaging	Het
Ccr3	T	C	9: 124,028,772	V48A	probably damaging	Het
Cebpd	G	A	16: 15,888,114	G264S	probably benign	Het
Chd1	C	A	17: 15,733,124	S440R	probably damaging	Het
Clip1	T	A	5: 123,631,023	E504D	probably damaging	Het
Cmya5	T	C	13: 93,093,574	R1669G	probably benign	Het
Col11a2	T	A	17: 34,050,963	F456I	probably damaging	Het
Col4a3bp	C	T	13: 96,616,487	P350S	probably benign	Het
Ctnna2	A	T	6: 76,980,781	M130K	probably damaging	Het
Elmo2	A	T	2: 165,292,002		probably benign	Het
F11	T	C	8: 45,255,342	D27G	probably damaging	Het
Faap100	A	T	11: 120,375,586		probably null	Het
Fat1	A	G	8: 44,989,114	E1151G	probably damaging	Het
Fbll1	T	A	11: 35,797,825	I204F	probably damaging	Het
Gle1	T	A	2: 29,940,203	V257D	possibly damaging	Het
Hoxc9	T	A	15: 102,981,793	C47*	probably null	Het
Hsd17b6	A	G	10: 127,993,655	V226A	probably benign	Het
Hsd17b7	C	T	1: 169,961,195	R151Q	probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Ido2	A	G	8: 24,533,859	I321T	probably benign	Het
Irf2bp2	T	C	8: 126,591,433	T465A	probably benign	Het
Kdm2a	A	G	19: 4,362,787	M34T	probably damaging	Het
Klhl6	C	T	16: 19,957,028	R260H	probably damaging	Het
Kntc1	T	A	5: 123,790,133	L1231*	probably null	Het
Lca5l	A	C	16: 96,162,029	Y412*	probably null	Het
Lipt1	T	C	1: 37,875,432	S190P	possibly damaging	Het
Ly6f	T	A	15: 75,271,720	V92D	probably damaging	Het
Matn4	T	A	2: 164,393,231	M433L	probably benign	Het
Mbtd1	C	A	11: 93,925,702	P370T	probably benign	Het
Mcph1	T	A	8: 18,632,687		probably null	Het
Muc5b	T	A	7: 141,864,185	C3623S	probably damaging	Het
Myt1l	C	A	12: 29,849,400	H134N	probably benign	Het
Nav2	A	T	7: 49,409,001		probably benign	Het
Ndufaf8	T	C	11: 120,099,166	C35R	probably damaging	Het
Neb	G	A	2: 52,204,879	T5130I	possibly damaging	Het
Nlrp9c	T	C	7: 26,380,564	N624S	possibly damaging	Het
Nr0b2	C	A	4: 133,556,023	H190Q	probably damaging	Het
Nrg4	A	G	9: 55,249,121		probably benign	Het
Nup88	A	T	11: 70,961,624	V215E	probably benign	Het
Oas2	T	G	5: 120,738,346	T511P	probably benign	Het
Olfr1151	T	C	2: 87,857,277	V34A	probably benign	Het
Olfr1162	A	C	2: 88,050,088	F179V	probably damaging	Het
Olfr1500	A	C	19: 13,828,354	L14R	probably damaging	Het
Olfr384	A	G	11: 73,602,600	T7A	possibly damaging	Het
Olfr720	A	G	14: 14,175,885	S66P	probably damaging	Het
Olfr943	A	G	9: 39,184,205	N9S	probably benign	Het
Pcdhgb2	T	A	18: 37,690,449	N164K	probably damaging	Het
Pde4d	C	G	13: 109,116,866	P76A	probably benign	Het
Phlda1	T	C	10: 111,507,655		probably benign	Het
Plekhh1	A	G	12: 79,054,803	T216A	probably benign	Het
Plppr3	T	A	10: 79,865,673	E445V	possibly damaging	Het
Prom1	A	G	5: 44,034,390	V337A	probably damaging	Het
Prr14l	T	C	5: 32,844,399		probably benign	Het
Psmd1	A	G	1: 86,137,098	I951V	probably benign	Het
Rab35	T	G	5: 115,643,395	I85M	possibly damaging	Het
Rad9a	A	T	19: 4,200,537	S93T	probably benign	Het
Ric1	G	A	19: 29,585,842	C555Y	probably damaging	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Rps8	G	C	4: 117,155,155		probably benign	Het
Sdr16c5	C	T	4: 4,016,216	W70*	probably null	Het
Senp3	A	G	11: 69,677,995	V408A	probably benign	Het
Sh2d4b	C	A	14: 40,840,344	W288L	probably benign	Het
Slc38a9	A	T	13: 112,723,298	D422V	probably damaging	Het
Slc4a2	T	C	5: 24,440,143	F1104L	probably damaging	Het
Slc4a3	A	G	1: 75,550,623	K113E	possibly damaging	Het
Spata3	G	A	1: 86,024,326		probably null	Het
Spata31d1d	A	T	13: 59,729,241	V160E	possibly damaging	Het
Sprr2f	A	G	3: 92,365,896	M1V	probably null	Het
Sptbn1	A	G	11: 30,118,295	V1733A	possibly damaging	Het
Syce1	C	A	7: 140,779,896	L83F	probably damaging	Het
Tardbp	A	G	4: 148,617,593	I295T	probably benign	Het
Tmem212	A	G	3: 27,885,008	S110P	probably damaging	Het
Tnc	G	A	4: 64,017,620	Q360*	probably null	Het
Tnrc6c	C	A	11: 117,722,905	Q630K	probably damaging	Het
Ttc19	G	A	11: 62,309,096	R235H	probably benign	Het
Ube3b	T	A	5: 114,415,726		probably null	Het
Vmn2r31	C	T	7: 7,387,063		probably null	Het
Vmn2r92	T	A	17: 18,151,921		probably benign	Het
Washc5	A	T	15: 59,333,636	Y685*	probably null	Het
Wdr93	T	A	7: 79,750,069	Y135*	probably null	Het
Wdr95	T	A	5: 149,595,332	I546K	probably damaging	Het
Zbtb38	T	A	9: 96,688,201	T277S	probably benign	Het
Zfp13	T	C	17: 23,576,823	D258G	possibly damaging	Het
Zfp397	T	A	18: 23,960,192	S245T	probably benign	Het
Zfp646	T	C	7: 127,883,735	Y1695H	probably benign	Het

Other mutations in Ror2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Ror2	APN	13	53113082	missense	probably benign	0.01
IGL01523:Ror2	APN	13	53118963	missense	probably benign	0.02
IGL01599:Ror2	APN	13	53111617	missense	probably damaging	1.00
IGL01669:Ror2	APN	13	53111088	missense	probably damaging	1.00
IGL02016:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02138:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02139:Ror2	APN	13	53111164	missense	probably damaging	1.00
IGL02172:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02173:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02176:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02177:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02178:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02179:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02182:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02189:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02190:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02203:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02230:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02231:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02234:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02423:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02424:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02478:Ror2	APN	13	53121667	missense	probably damaging	1.00
IGL02479:Ror2	APN	13	53131932	missense	possibly damaging	0.62
IGL02517:Ror2	APN	13	53118840	missense	probably damaging	1.00
IGL02554:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02618:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02619:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02622:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02623:Ror2	APN	13	53110728	missense	probably damaging	1.00
willowy	UTSW	13	53131919	missense	probably damaging	1.00
R0076:Ror2	UTSW	13	53113074	missense	probably benign	0.02
R0375:Ror2	UTSW	13	53132004	missense	probably damaging	1.00
R0826:Ror2	UTSW	13	53113217	missense	probably damaging	1.00
R1823:Ror2	UTSW	13	53110305	missense	probably benign	0.07
R1895:Ror2	UTSW	13	53131849	missense	probably damaging	1.00
R1946:Ror2	UTSW	13	53131849	missense	probably damaging	1.00
R1983:Ror2	UTSW	13	53110408	missense	probably benign	0.01
R2031:Ror2	UTSW	13	53117330	missense	probably benign	0.01
R2197:Ror2	UTSW	13	53285780	critical splice donor site	probably null
R2246:Ror2	UTSW	13	53111602	missense	probably damaging	1.00
R2405:Ror2	UTSW	13	53130944	missense	possibly damaging	0.67
R2411:Ror2	UTSW	13	53130944	missense	possibly damaging	0.67
R2905:Ror2	UTSW	13	53131995	missense	probably benign	0.01
R3156:Ror2	UTSW	13	53117364	missense	probably damaging	0.98
R4198:Ror2	UTSW	13	53110644	missense	probably benign	0.08
R4408:Ror2	UTSW	13	53118961	missense	probably damaging	1.00
R4469:Ror2	UTSW	13	53131980	missense	possibly damaging	0.87
R4648:Ror2	UTSW	13	53285500	nonsense	probably null
R4705:Ror2	UTSW	13	53117297	missense	probably benign	0.00
R4831:Ror2	UTSW	13	53118844	missense	probably damaging	0.97
R4951:Ror2	UTSW	13	53117147	missense	probably benign	0.00
R4975:Ror2	UTSW	13	53131918	missense	probably damaging	1.00
R5380:Ror2	UTSW	13	53117149	missense	possibly damaging	0.73
R5469:Ror2	UTSW	13	53117339	missense	probably benign	0.00
R5604:Ror2	UTSW	13	53117165	missense	probably benign	0.01
R6188:Ror2	UTSW	13	53111311	missense	probably damaging	0.98
R6221:Ror2	UTSW	13	53113217	missense	probably damaging	1.00
R6243:Ror2	UTSW	13	53113080	missense	probably benign
R6255:Ror2	UTSW	13	53110542	missense	probably damaging	1.00
R6497:Ror2	UTSW	13	53131919	missense	probably damaging	1.00
R6717:Ror2	UTSW	13	53118982	missense	probably damaging	1.00
R6918:Ror2	UTSW	13	53111451	missense	probably damaging	0.96
R7092:Ror2	UTSW	13	53110236	missense	probably benign
R7134:Ror2	UTSW	13	53146706	missense	probably benign	0.00
R7254:Ror2	UTSW	13	53118720	missense	possibly damaging	0.72
R7517:Ror2	UTSW	13	53110865	missense	possibly damaging	0.86
R7560:Ror2	UTSW	13	53110813	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- TCCGCCACAGATGTATTGG -3'
(R):5'- AATGAGTTCCCAAGCCGGAG -3'

Sequencing Primer
(F):5'- CCACAGATGTATTGGAGGGC -3'
(R):5'- AGGCCCCGCTTTAAGGACATC -3'

Posted On

2016-03-01