Incidental Mutation 'R4824:Cmya5'
ID 374256
Institutional Source Beutler Lab
Gene Symbol Cmya5
Ensembl Gene ENSMUSG00000047419
Gene Name cardiomyopathy associated 5
Synonyms Myospryn, 2310076E16Rik, 2310076E21Rik
MMRRC Submission 042440-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.299) question?
Stock # R4824 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 93177221-93281232 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 93230082 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 1669 (R1669G)
Ref Sequence ENSEMBL: ENSMUSP00000050408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062122]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000062122
AA Change: R1669G

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000050408
Gene: ENSMUSG00000047419
AA Change: R1669G

DomainStartEndE-ValueType
low complexity region 20 46 N/A INTRINSIC
low complexity region 129 140 N/A INTRINSIC
internal_repeat_1 448 535 5.09e-18 PROSPERO
internal_repeat_1 543 625 5.09e-18 PROSPERO
low complexity region 626 645 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
low complexity region 734 741 N/A INTRINSIC
low complexity region 1001 1010 N/A INTRINSIC
low complexity region 1166 1183 N/A INTRINSIC
low complexity region 1259 1267 N/A INTRINSIC
low complexity region 1440 1449 N/A INTRINSIC
low complexity region 1876 1889 N/A INTRINSIC
low complexity region 2632 2645 N/A INTRINSIC
low complexity region 3048 3057 N/A INTRINSIC
FN3 3312 3399 7.29e-4 SMART
FN3 3411 3492 1.3e0 SMART
Pfam:SPRY 3551 3668 6.7e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224009
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 98% (123/126)
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 137,771,437 (GRCm39) T209A probably benign Het
1700086D15Rik T C 11: 65,043,441 (GRCm39) probably benign Het
A130010J15Rik G A 1: 192,856,965 (GRCm39) V106I probably benign Het
Abca16 C A 7: 120,074,702 (GRCm39) N580K possibly damaging Het
Actrt2 A T 4: 154,751,344 (GRCm39) F264Y probably damaging Het
Adh4 G A 3: 138,134,807 (GRCm39) S327N possibly damaging Het
Alkbh5 T C 11: 60,444,697 (GRCm39) probably null Het
Anapc1 T A 2: 128,470,610 (GRCm39) T1507S possibly damaging Het
Anapc2 A G 2: 25,167,764 (GRCm39) R444G probably damaging Het
Apoh G T 11: 108,305,087 (GRCm39) W335L probably benign Het
B4galt7 A T 13: 55,752,162 (GRCm39) H71L possibly damaging Het
Bicd2 A G 13: 49,532,488 (GRCm39) E358G probably damaging Het
Bmper T A 9: 23,134,956 (GRCm39) V7D possibly damaging Het
Brca2 T C 5: 150,463,200 (GRCm39) F988S probably damaging Het
Brix1 A G 15: 10,485,828 (GRCm39) V49A possibly damaging Het
Brpf3 T C 17: 29,025,460 (GRCm39) S178P probably benign Het
Btaf1 A G 19: 36,958,448 (GRCm39) Y655C possibly damaging Het
C1rl C G 6: 124,486,040 (GRCm39) Y470* probably null Het
Cacnb4 A G 2: 52,565,822 (GRCm39) V21A probably benign Het
Caskin1 C A 17: 24,720,103 (GRCm39) P437T probably benign Het
Casz1 C A 4: 149,029,028 (GRCm39) P1158T probably damaging Het
Ccdc141 T A 2: 76,954,680 (GRCm39) Q189L probably damaging Het
Ccr3 T C 9: 123,828,809 (GRCm39) V48A probably damaging Het
Cebpd G A 16: 15,705,978 (GRCm39) G264S probably benign Het
Cert1 C T 13: 96,752,995 (GRCm39) P350S probably benign Het
Cfap20dc A T 14: 8,665,997 (GRCm38) M1K probably null Het
Chd1 C A 17: 15,953,386 (GRCm39) S440R probably damaging Het
Clip1 T A 5: 123,769,086 (GRCm39) E504D probably damaging Het
Col11a2 T A 17: 34,269,937 (GRCm39) F456I probably damaging Het
Ctnna2 A T 6: 76,957,764 (GRCm39) M130K probably damaging Het
Elmo2 A T 2: 165,133,922 (GRCm39) probably benign Het
F11 T C 8: 45,708,379 (GRCm39) D27G probably damaging Het
Faap100 A T 11: 120,266,412 (GRCm39) probably null Het
Fat1 A G 8: 45,442,151 (GRCm39) E1151G probably damaging Het
Fbll1 T A 11: 35,688,652 (GRCm39) I204F probably damaging Het
Gle1 T A 2: 29,830,215 (GRCm39) V257D possibly damaging Het
Hoxc9 T A 15: 102,890,225 (GRCm39) C47* probably null Het
Hsd17b6 A G 10: 127,829,524 (GRCm39) V226A probably benign Het
Hsd17b7 C T 1: 169,788,764 (GRCm39) R151Q probably benign Het
Hsh2d G A 8: 72,954,304 (GRCm39) D229N probably benign Het
Ido2 A G 8: 25,023,875 (GRCm39) I321T probably benign Het
Irf2bp2 T C 8: 127,318,172 (GRCm39) T465A probably benign Het
Kdm2a A G 19: 4,412,815 (GRCm39) M34T probably damaging Het
Klhl6 C T 16: 19,775,778 (GRCm39) R260H probably damaging Het
Kntc1 T A 5: 123,928,196 (GRCm39) L1231* probably null Het
Lca5l A C 16: 95,963,229 (GRCm39) Y412* probably null Het
Lipt1 T C 1: 37,914,513 (GRCm39) S190P possibly damaging Het
Ly6f T A 15: 75,143,569 (GRCm39) V92D probably damaging Het
Matn4 T A 2: 164,235,151 (GRCm39) M433L probably benign Het
Mbtd1 C A 11: 93,816,528 (GRCm39) P370T probably benign Het
Mcph1 T A 8: 18,682,703 (GRCm39) probably null Het
Muc5b T A 7: 141,417,922 (GRCm39) C3623S probably damaging Het
Myt1l C A 12: 29,899,399 (GRCm39) H134N probably benign Het
Nav2 A T 7: 49,058,749 (GRCm39) probably benign Het
Ndufaf8 T C 11: 119,989,992 (GRCm39) C35R probably damaging Het
Neb G A 2: 52,094,891 (GRCm39) T5130I possibly damaging Het
Nlrp9c T C 7: 26,079,989 (GRCm39) N624S possibly damaging Het
Nr0b2 C A 4: 133,283,334 (GRCm39) H190Q probably damaging Het
Nrg4 A G 9: 55,156,405 (GRCm39) probably benign Het
Nup88 A T 11: 70,852,450 (GRCm39) V215E probably benign Het
Oas2 T G 5: 120,876,411 (GRCm39) T511P probably benign Het
Or1e25 A G 11: 73,493,426 (GRCm39) T7A possibly damaging Het
Or2t6 A G 14: 14,175,885 (GRCm38) S66P probably damaging Het
Or5d14 A C 2: 87,880,432 (GRCm39) F179V probably damaging Het
Or5w8 T C 2: 87,687,621 (GRCm39) V34A probably benign Het
Or8g26 A G 9: 39,095,501 (GRCm39) N9S probably benign Het
Or9q1 A C 19: 13,805,718 (GRCm39) L14R probably damaging Het
Pcdhgb2 T A 18: 37,823,502 (GRCm39) N164K probably damaging Het
Pde4d C G 13: 109,253,400 (GRCm39) P76A probably benign Het
Phlda1 T C 10: 111,343,516 (GRCm39) probably benign Het
Plekhh1 A G 12: 79,101,577 (GRCm39) T216A probably benign Het
Plppr3 T A 10: 79,701,507 (GRCm39) E445V possibly damaging Het
Prom1 A G 5: 44,191,732 (GRCm39) V337A probably damaging Het
Prr14l T C 5: 33,001,743 (GRCm39) probably benign Het
Psmd1 A G 1: 86,064,820 (GRCm39) I951V probably benign Het
Rab35 T G 5: 115,781,454 (GRCm39) I85M possibly damaging Het
Rad9a A T 19: 4,250,536 (GRCm39) S93T probably benign Het
Ric1 G A 19: 29,563,242 (GRCm39) C555Y probably damaging Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Ror2 T A 13: 53,264,719 (GRCm39) Q791L probably benign Het
Rps8 G C 4: 117,012,352 (GRCm39) probably benign Het
Sdr16c5 C T 4: 4,016,216 (GRCm39) W70* probably null Het
Senp3 A G 11: 69,568,821 (GRCm39) V408A probably benign Het
Sh2d4b C A 14: 40,562,301 (GRCm39) W288L probably benign Het
Slc38a9 A T 13: 112,859,832 (GRCm39) D422V probably damaging Het
Slc4a2 T C 5: 24,645,141 (GRCm39) F1104L probably damaging Het
Slc4a3 A G 1: 75,527,267 (GRCm39) K113E possibly damaging Het
Spata3 G A 1: 85,952,048 (GRCm39) probably null Het
Spata31d1d A T 13: 59,877,055 (GRCm39) V160E possibly damaging Het
Sprr2f A G 3: 92,273,203 (GRCm39) M1V probably null Het
Sptbn1 A G 11: 30,068,295 (GRCm39) V1733A possibly damaging Het
Syce1 C A 7: 140,359,809 (GRCm39) L83F probably damaging Het
Tardbp A G 4: 148,702,050 (GRCm39) I295T probably benign Het
Tmem212 A G 3: 27,939,157 (GRCm39) S110P probably damaging Het
Tnc G A 4: 63,935,857 (GRCm39) Q360* probably null Het
Tnrc6c C A 11: 117,613,731 (GRCm39) Q630K probably damaging Het
Ttc19 G A 11: 62,199,922 (GRCm39) R235H probably benign Het
Ube3b T A 5: 114,553,787 (GRCm39) probably null Het
Vmn2r31 C T 7: 7,390,062 (GRCm39) probably null Het
Vmn2r92 T A 17: 18,372,183 (GRCm39) probably benign Het
Washc5 A T 15: 59,205,485 (GRCm39) Y685* probably null Het
Wdr93 T A 7: 79,399,817 (GRCm39) Y135* probably null Het
Wdr95 T A 5: 149,518,797 (GRCm39) I546K probably damaging Het
Zbtb38 T A 9: 96,570,254 (GRCm39) T277S probably benign Het
Zfp13 T C 17: 23,795,797 (GRCm39) D258G possibly damaging Het
Zfp397 T A 18: 24,093,249 (GRCm39) S245T probably benign Het
Zfp646 T C 7: 127,482,907 (GRCm39) Y1695H probably benign Het
Other mutations in Cmya5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Cmya5 APN 13 93,229,628 (GRCm39) missense probably benign 0.13
IGL00516:Cmya5 APN 13 93,234,675 (GRCm39) missense possibly damaging 0.73
IGL00654:Cmya5 APN 13 93,230,669 (GRCm39) missense probably benign 0.00
IGL00948:Cmya5 APN 13 93,227,544 (GRCm39) missense probably benign
IGL00966:Cmya5 APN 13 93,234,414 (GRCm39) missense probably benign 0.33
IGL00988:Cmya5 APN 13 93,234,441 (GRCm39) missense possibly damaging 0.96
IGL01106:Cmya5 APN 13 93,221,120 (GRCm39) missense probably damaging 1.00
IGL01331:Cmya5 APN 13 93,233,454 (GRCm39) missense possibly damaging 0.53
IGL01392:Cmya5 APN 13 93,225,714 (GRCm39) missense probably damaging 0.99
IGL01508:Cmya5 APN 13 93,230,535 (GRCm39) missense probably benign
IGL01679:Cmya5 APN 13 93,201,828 (GRCm39) missense probably damaging 1.00
IGL01749:Cmya5 APN 13 93,225,807 (GRCm39) missense probably benign 0.00
IGL01861:Cmya5 APN 13 93,226,256 (GRCm39) missense probably damaging 1.00
IGL02021:Cmya5 APN 13 93,231,057 (GRCm39) missense probably benign 0.00
IGL02034:Cmya5 APN 13 93,221,043 (GRCm39) splice site probably benign
IGL02103:Cmya5 APN 13 93,228,635 (GRCm39) missense probably benign 0.05
IGL02174:Cmya5 APN 13 93,185,415 (GRCm39) missense possibly damaging 0.76
IGL02176:Cmya5 APN 13 93,226,658 (GRCm39) missense probably damaging 1.00
IGL02210:Cmya5 APN 13 93,229,242 (GRCm39) missense probably benign 0.14
IGL02229:Cmya5 APN 13 93,229,194 (GRCm39) missense possibly damaging 0.54
IGL02306:Cmya5 APN 13 93,234,527 (GRCm39) missense probably damaging 1.00
IGL02311:Cmya5 APN 13 93,227,163 (GRCm39) missense probably benign 0.40
IGL02409:Cmya5 APN 13 93,226,706 (GRCm39) missense probably damaging 0.96
IGL02561:Cmya5 APN 13 93,228,366 (GRCm39) missense probably benign 0.00
IGL02676:Cmya5 APN 13 93,229,361 (GRCm39) missense probably damaging 1.00
IGL02683:Cmya5 APN 13 93,227,505 (GRCm39) nonsense probably null
IGL02685:Cmya5 APN 13 93,227,505 (GRCm39) nonsense probably null
IGL02686:Cmya5 APN 13 93,227,505 (GRCm39) nonsense probably null
IGL02724:Cmya5 APN 13 93,233,163 (GRCm39) missense probably benign
IGL02727:Cmya5 APN 13 93,234,753 (GRCm39) missense possibly damaging 0.73
IGL02965:Cmya5 APN 13 93,229,065 (GRCm39) missense probably benign 0.41
IGL03079:Cmya5 APN 13 93,234,209 (GRCm39) missense possibly damaging 0.85
IGL03144:Cmya5 APN 13 93,227,376 (GRCm39) missense probably damaging 1.00
IGL03253:Cmya5 APN 13 93,227,778 (GRCm39) nonsense probably null
IGL03336:Cmya5 APN 13 93,230,013 (GRCm39) missense possibly damaging 0.84
IGL03138:Cmya5 UTSW 13 93,201,850 (GRCm39) missense probably damaging 1.00
P0023:Cmya5 UTSW 13 93,225,854 (GRCm39) missense probably benign 0.22
P4748:Cmya5 UTSW 13 93,210,983 (GRCm39) splice site probably benign
R0123:Cmya5 UTSW 13 93,232,412 (GRCm39) missense possibly damaging 0.84
R0206:Cmya5 UTSW 13 93,232,065 (GRCm39) missense probably damaging 0.98
R0206:Cmya5 UTSW 13 93,232,065 (GRCm39) missense probably damaging 0.98
R0242:Cmya5 UTSW 13 93,232,108 (GRCm39) missense probably benign
R0242:Cmya5 UTSW 13 93,232,108 (GRCm39) missense probably benign
R0331:Cmya5 UTSW 13 93,280,911 (GRCm39) missense possibly damaging 0.53
R0363:Cmya5 UTSW 13 93,231,377 (GRCm39) missense possibly damaging 0.77
R0382:Cmya5 UTSW 13 93,229,256 (GRCm39) missense probably benign 0.06
R0416:Cmya5 UTSW 13 93,226,364 (GRCm39) missense probably benign 0.05
R0446:Cmya5 UTSW 13 93,230,164 (GRCm39) missense probably benign
R0457:Cmya5 UTSW 13 93,232,095 (GRCm39) missense possibly damaging 0.84
R0673:Cmya5 UTSW 13 93,226,505 (GRCm39) missense probably damaging 1.00
R0674:Cmya5 UTSW 13 93,229,299 (GRCm39) missense probably damaging 1.00
R0692:Cmya5 UTSW 13 93,230,357 (GRCm39) nonsense probably null
R0698:Cmya5 UTSW 13 93,232,065 (GRCm39) missense probably damaging 0.98
R1227:Cmya5 UTSW 13 93,230,954 (GRCm39) missense probably damaging 0.99
R1272:Cmya5 UTSW 13 93,231,620 (GRCm39) missense possibly damaging 0.79
R1335:Cmya5 UTSW 13 93,178,043 (GRCm39) missense possibly damaging 0.65
R1353:Cmya5 UTSW 13 93,178,033 (GRCm39) missense probably damaging 1.00
R1354:Cmya5 UTSW 13 93,228,566 (GRCm39) missense possibly damaging 0.46
R1458:Cmya5 UTSW 13 93,201,835 (GRCm39) missense probably benign 0.44
R1572:Cmya5 UTSW 13 93,230,777 (GRCm39) missense possibly damaging 0.61
R1698:Cmya5 UTSW 13 93,200,027 (GRCm39) missense probably benign 0.27
R1735:Cmya5 UTSW 13 93,226,297 (GRCm39) missense probably benign 0.11
R1743:Cmya5 UTSW 13 93,233,825 (GRCm39) missense probably benign 0.33
R1750:Cmya5 UTSW 13 93,232,171 (GRCm39) missense probably benign
R1827:Cmya5 UTSW 13 93,210,956 (GRCm39) missense possibly damaging 0.80
R2068:Cmya5 UTSW 13 93,227,032 (GRCm39) missense possibly damaging 0.93
R2088:Cmya5 UTSW 13 93,229,320 (GRCm39) missense probably damaging 1.00
R2132:Cmya5 UTSW 13 93,205,891 (GRCm39) missense probably damaging 1.00
R2216:Cmya5 UTSW 13 93,230,003 (GRCm39) missense probably damaging 1.00
R2363:Cmya5 UTSW 13 93,230,210 (GRCm39) missense probably benign 0.15
R2497:Cmya5 UTSW 13 93,234,513 (GRCm39) missense possibly damaging 0.53
R2509:Cmya5 UTSW 13 93,230,066 (GRCm39) missense probably benign 0.41
R2917:Cmya5 UTSW 13 93,227,572 (GRCm39) nonsense probably null
R2944:Cmya5 UTSW 13 93,229,350 (GRCm39) nonsense probably null
R3039:Cmya5 UTSW 13 93,228,758 (GRCm39) missense probably benign 0.12
R3078:Cmya5 UTSW 13 93,185,435 (GRCm39) missense probably damaging 0.99
R3708:Cmya5 UTSW 13 93,231,874 (GRCm39) nonsense probably null
R3717:Cmya5 UTSW 13 93,228,995 (GRCm39) missense probably benign 0.12
R3768:Cmya5 UTSW 13 93,233,201 (GRCm39) missense possibly damaging 0.73
R3769:Cmya5 UTSW 13 93,233,201 (GRCm39) missense possibly damaging 0.73
R3840:Cmya5 UTSW 13 93,231,140 (GRCm39) missense probably damaging 0.96
R3841:Cmya5 UTSW 13 93,231,140 (GRCm39) missense probably damaging 0.96
R3882:Cmya5 UTSW 13 93,227,727 (GRCm39) missense probably benign 0.07
R3888:Cmya5 UTSW 13 93,230,164 (GRCm39) missense probably benign
R3897:Cmya5 UTSW 13 93,233,189 (GRCm39) missense possibly damaging 0.72
R3952:Cmya5 UTSW 13 93,225,707 (GRCm39) missense possibly damaging 0.89
R4366:Cmya5 UTSW 13 93,228,464 (GRCm39) missense probably benign 0.36
R4471:Cmya5 UTSW 13 93,228,833 (GRCm39) missense probably benign 0.01
R4493:Cmya5 UTSW 13 93,230,573 (GRCm39) missense probably benign
R4495:Cmya5 UTSW 13 93,230,573 (GRCm39) missense probably benign
R4544:Cmya5 UTSW 13 93,228,426 (GRCm39) nonsense probably null
R4545:Cmya5 UTSW 13 93,228,426 (GRCm39) nonsense probably null
R4624:Cmya5 UTSW 13 93,200,059 (GRCm39) missense probably damaging 1.00
R4648:Cmya5 UTSW 13 93,230,336 (GRCm39) missense possibly damaging 0.84
R4965:Cmya5 UTSW 13 93,232,295 (GRCm39) missense possibly damaging 0.84
R4967:Cmya5 UTSW 13 93,227,093 (GRCm39) missense probably damaging 1.00
R5101:Cmya5 UTSW 13 93,228,111 (GRCm39) missense possibly damaging 0.61
R5133:Cmya5 UTSW 13 93,229,880 (GRCm39) missense possibly damaging 0.79
R5139:Cmya5 UTSW 13 93,232,569 (GRCm39) missense probably benign 0.00
R5220:Cmya5 UTSW 13 93,228,804 (GRCm39) missense probably damaging 0.99
R5332:Cmya5 UTSW 13 93,232,703 (GRCm39) missense probably damaging 0.96
R5337:Cmya5 UTSW 13 93,219,781 (GRCm39) missense probably benign 0.28
R5356:Cmya5 UTSW 13 93,199,993 (GRCm39) missense probably damaging 1.00
R5401:Cmya5 UTSW 13 93,228,476 (GRCm39) missense probably damaging 1.00
R5438:Cmya5 UTSW 13 93,231,707 (GRCm39) missense possibly damaging 0.89
R5604:Cmya5 UTSW 13 93,229,271 (GRCm39) missense probably benign 0.15
R5628:Cmya5 UTSW 13 93,226,218 (GRCm39) missense probably damaging 1.00
R5666:Cmya5 UTSW 13 93,182,457 (GRCm39) missense possibly damaging 0.75
R5687:Cmya5 UTSW 13 93,234,684 (GRCm39) missense possibly damaging 0.53
R5695:Cmya5 UTSW 13 93,182,374 (GRCm39) critical splice donor site probably null
R5806:Cmya5 UTSW 13 93,230,445 (GRCm39) missense possibly damaging 0.84
R5820:Cmya5 UTSW 13 93,229,288 (GRCm39) missense probably benign 0.04
R5872:Cmya5 UTSW 13 93,233,943 (GRCm39) missense probably benign 0.01
R5875:Cmya5 UTSW 13 93,231,692 (GRCm39) missense probably benign 0.13
R5896:Cmya5 UTSW 13 93,182,373 (GRCm39) critical splice donor site probably null
R5910:Cmya5 UTSW 13 93,229,151 (GRCm39) missense probably damaging 0.98
R5969:Cmya5 UTSW 13 93,226,052 (GRCm39) missense possibly damaging 0.78
R6064:Cmya5 UTSW 13 93,226,157 (GRCm39) missense probably damaging 1.00
R6081:Cmya5 UTSW 13 93,281,021 (GRCm39) unclassified probably benign
R6102:Cmya5 UTSW 13 93,230,739 (GRCm39) missense probably benign
R6117:Cmya5 UTSW 13 93,231,674 (GRCm39) missense probably damaging 0.98
R6188:Cmya5 UTSW 13 93,233,784 (GRCm39) missense possibly damaging 0.73
R6188:Cmya5 UTSW 13 93,229,952 (GRCm39) missense possibly damaging 0.61
R6219:Cmya5 UTSW 13 93,230,951 (GRCm39) missense probably damaging 1.00
R6229:Cmya5 UTSW 13 93,229,814 (GRCm39) missense probably benign 0.41
R6346:Cmya5 UTSW 13 93,228,698 (GRCm39) missense probably damaging 1.00
R6431:Cmya5 UTSW 13 93,210,972 (GRCm39) missense possibly damaging 0.60
R6436:Cmya5 UTSW 13 93,225,723 (GRCm39) missense probably damaging 0.98
R6598:Cmya5 UTSW 13 93,226,316 (GRCm39) missense probably benign 0.05
R6649:Cmya5 UTSW 13 93,234,533 (GRCm39) missense possibly damaging 0.91
R6652:Cmya5 UTSW 13 93,229,547 (GRCm39) missense probably damaging 0.99
R6652:Cmya5 UTSW 13 93,229,403 (GRCm39) missense probably benign 0.04
R6669:Cmya5 UTSW 13 93,229,767 (GRCm39) missense probably benign 0.03
R6881:Cmya5 UTSW 13 93,226,800 (GRCm39) missense probably damaging 1.00
R6909:Cmya5 UTSW 13 93,227,760 (GRCm39) missense probably benign 0.04
R6933:Cmya5 UTSW 13 93,231,644 (GRCm39) missense probably benign 0.03
R7021:Cmya5 UTSW 13 93,230,063 (GRCm39) missense possibly damaging 0.62
R7022:Cmya5 UTSW 13 93,205,786 (GRCm39) critical splice donor site probably null
R7068:Cmya5 UTSW 13 93,229,205 (GRCm39) missense possibly damaging 0.59
R7087:Cmya5 UTSW 13 93,227,483 (GRCm39) missense probably benign 0.00
R7088:Cmya5 UTSW 13 93,228,372 (GRCm39) missense possibly damaging 0.95
R7126:Cmya5 UTSW 13 93,226,448 (GRCm39) missense probably benign 0.41
R7177:Cmya5 UTSW 13 93,231,836 (GRCm39) missense probably benign 0.00
R7188:Cmya5 UTSW 13 93,182,546 (GRCm39) missense probably damaging 1.00
R7217:Cmya5 UTSW 13 93,226,938 (GRCm39) missense probably damaging 1.00
R7278:Cmya5 UTSW 13 93,232,208 (GRCm39) missense probably damaging 0.96
R7293:Cmya5 UTSW 13 93,229,305 (GRCm39) missense possibly damaging 0.90
R7332:Cmya5 UTSW 13 93,229,061 (GRCm39) missense possibly damaging 0.60
R7375:Cmya5 UTSW 13 93,228,169 (GRCm39) missense probably damaging 0.97
R7386:Cmya5 UTSW 13 93,205,831 (GRCm39) missense probably damaging 1.00
R7489:Cmya5 UTSW 13 93,228,346 (GRCm39) missense possibly damaging 0.87
R7529:Cmya5 UTSW 13 93,233,942 (GRCm39) missense probably benign 0.02
R7552:Cmya5 UTSW 13 93,205,820 (GRCm39) missense probably benign 0.41
R7624:Cmya5 UTSW 13 93,226,865 (GRCm39) missense possibly damaging 0.79
R7637:Cmya5 UTSW 13 93,219,720 (GRCm39) missense possibly damaging 0.87
R7673:Cmya5 UTSW 13 93,230,629 (GRCm39) missense probably benign 0.13
R7753:Cmya5 UTSW 13 93,234,680 (GRCm39) missense probably benign 0.18
R7757:Cmya5 UTSW 13 93,234,780 (GRCm39) missense possibly damaging 0.53
R7806:Cmya5 UTSW 13 93,230,770 (GRCm39) missense probably benign 0.00
R7825:Cmya5 UTSW 13 93,234,136 (GRCm39) missense possibly damaging 0.53
R7878:Cmya5 UTSW 13 93,226,265 (GRCm39) missense probably damaging 0.98
R7892:Cmya5 UTSW 13 93,232,865 (GRCm39) missense probably damaging 0.96
R7952:Cmya5 UTSW 13 93,233,512 (GRCm39) small deletion probably benign
R8127:Cmya5 UTSW 13 93,231,122 (GRCm39) missense probably damaging 0.99
R8256:Cmya5 UTSW 13 93,229,986 (GRCm39) missense possibly damaging 0.62
R8339:Cmya5 UTSW 13 93,228,142 (GRCm39) nonsense probably null
R8446:Cmya5 UTSW 13 93,230,336 (GRCm39) missense possibly damaging 0.84
R8553:Cmya5 UTSW 13 93,230,304 (GRCm39) missense probably benign 0.00
R8686:Cmya5 UTSW 13 93,231,888 (GRCm39) missense possibly damaging 0.91
R8748:Cmya5 UTSW 13 93,226,229 (GRCm39) missense probably damaging 1.00
R8783:Cmya5 UTSW 13 93,225,888 (GRCm39) missense possibly damaging 0.58
R8803:Cmya5 UTSW 13 93,177,991 (GRCm39) missense probably damaging 1.00
R8810:Cmya5 UTSW 13 93,200,048 (GRCm39) missense possibly damaging 0.47
R8937:Cmya5 UTSW 13 93,232,840 (GRCm39) missense probably benign 0.01
R8985:Cmya5 UTSW 13 93,233,664 (GRCm39) missense possibly damaging 0.73
R9017:Cmya5 UTSW 13 93,228,572 (GRCm39) missense probably benign 0.03
R9087:Cmya5 UTSW 13 93,233,711 (GRCm39) missense possibly damaging 0.72
R9133:Cmya5 UTSW 13 93,234,108 (GRCm39) missense possibly damaging 0.73
R9156:Cmya5 UTSW 13 93,233,878 (GRCm39) missense unknown
R9209:Cmya5 UTSW 13 93,226,866 (GRCm39) missense probably benign 0.45
R9222:Cmya5 UTSW 13 93,230,579 (GRCm39) missense probably benign 0.00
R9229:Cmya5 UTSW 13 93,232,176 (GRCm39) missense possibly damaging 0.92
R9382:Cmya5 UTSW 13 93,229,884 (GRCm39) missense probably benign
R9385:Cmya5 UTSW 13 93,230,880 (GRCm39) missense probably damaging 0.99
R9418:Cmya5 UTSW 13 93,226,209 (GRCm39) missense probably benign 0.22
R9452:Cmya5 UTSW 13 93,232,394 (GRCm39) missense probably benign
R9492:Cmya5 UTSW 13 93,177,822 (GRCm39) makesense probably null
R9600:Cmya5 UTSW 13 93,226,604 (GRCm39) missense probably damaging 1.00
R9712:Cmya5 UTSW 13 93,201,881 (GRCm39) critical splice acceptor site probably null
R9742:Cmya5 UTSW 13 93,231,935 (GRCm39) missense possibly damaging 0.89
RF020:Cmya5 UTSW 13 93,205,799 (GRCm39) missense possibly damaging 0.56
X0028:Cmya5 UTSW 13 93,233,195 (GRCm39) missense possibly damaging 0.53
Z1088:Cmya5 UTSW 13 93,200,087 (GRCm39) missense probably benign
Z1176:Cmya5 UTSW 13 93,233,298 (GRCm39) missense unknown
Z1176:Cmya5 UTSW 13 93,200,087 (GRCm39) missense probably benign
Z1177:Cmya5 UTSW 13 93,200,087 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGCTTATCTGCAGAAGAGC -3'
(R):5'- GGCAAGCAGAGGAGACATCTTC -3'

Sequencing Primer
(F):5'- CAGAAGAGCTGCTCTCATCAGG -3'
(R):5'- GAGACATCTTCTCCAGTGCCG -3'
Posted On 2016-03-01