Incidental Mutation 'R4861:Alpi'
ID374282
Institutional Source Beutler Lab
Gene Symbol Alpi
Ensembl Gene ENSMUSG00000079440
Gene Namealkaline phosphatase, intestinal
Synonyms2010001C14Rik
MMRRC Submission 042472-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R4861 (G1)
Quality Score203
Status Not validated
Chromosome1
Chromosomal Location87098002-87101606 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87100469 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 211 (I211F)
Ref Sequence ENSEMBL: ENSMUSP00000108895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113270]
Predicted Effect probably damaging
Transcript: ENSMUST00000113270
AA Change: I211F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108895
Gene: ENSMUSG00000079440
AA Change: I211F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
alkPPc 54 489 7.97e-247 SMART
low complexity region 509 532 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186823
Meta Mutation Damage Score 0.2656 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 87.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an alkaline phosphatase, a metalloenzyme that catalyzes the hydrolysis of phosphoric acid monoesters. It belongs to a multigene family composed of four alkaline phosphatase isoenzymes. The enzyme functions as a homodimer and has a catalytic site containing one magnesium and two zinc ions, which are required for its enzymatic function. The protein is primarily expressed in placental and endometrial tissue; however, strong ectopic expression has been detected in ovarian adenocarcinoma, serous cystadenocarcinoma, and other ovarian cancer cells. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,245,905 R1153H probably damaging Het
Ahcy T C 2: 155,060,516 E411G probably benign Het
Arfgef3 G A 10: 18,607,731 A1415V probably benign Het
Bora T C 14: 99,047,474 probably null Het
Car3 T C 3: 14,866,896 V109A probably damaging Het
Ccdc114 A G 7: 45,942,873 E359G probably damaging Het
Cdk13 A T 13: 17,766,586 V17D probably damaging Het
Cept1 A C 3: 106,505,732 S226A probably damaging Het
Dbt A T 3: 116,548,078 I443L probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Farp2 T C 1: 93,605,419 L633S probably damaging Het
Gm26727 T C 2: 67,432,945 I79M probably damaging Het
Gm5800 T A 14: 51,716,047 N37I probably damaging Het
Hapln1 G A 13: 89,601,452 G39S possibly damaging Het
Ice2 T A 9: 69,415,448 S408R probably benign Het
Lctl T C 9: 64,119,763 I131T possibly damaging Het
Ncoa7 T A 10: 30,704,612 M117L probably benign Het
Npy4r C T 14: 34,146,883 W149* probably null Het
Nr5a2 A G 1: 136,948,720 probably null Het
Plg G A 17: 12,395,735 E301K probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Rapgef2 T C 3: 79,074,436 K1084R probably benign Het
Slc41a2 T C 10: 83,316,458 Q51R probably damaging Het
Slc47a2 A T 11: 61,336,233 C170S probably benign Het
Slco1b2 A T 6: 141,671,222 N427I possibly damaging Het
Smc2 G A 4: 52,461,090 R571H probably benign Het
Sp4 G T 12: 118,300,811 probably null Het
Tas2r117 T C 6: 132,803,129 F77L probably benign Het
Tbcd C T 11: 121,601,961 R875C probably damaging Het
Thumpd2 A G 17: 81,026,801 S453P probably benign Het
Vars2 G T 17: 35,661,933 Q13K probably benign Het
Other mutations in Alpi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Alpi APN 1 87099720 missense probably damaging 1.00
IGL01972:Alpi APN 1 87099709 missense probably damaging 1.00
IGL02672:Alpi APN 1 87101272 missense probably damaging 1.00
IGL03089:Alpi APN 1 87100108 missense probably benign 0.05
IGL03099:Alpi APN 1 87098631 missense unknown
IGL03154:Alpi APN 1 87100088 missense probably damaging 1.00
IGL03372:Alpi APN 1 87100628 splice site probably benign
K7371:Alpi UTSW 1 87099171 splice site probably benign
R0053:Alpi UTSW 1 87098790 missense probably benign 0.03
R0054:Alpi UTSW 1 87099765 missense possibly damaging 0.61
R0070:Alpi UTSW 1 87101159 splice site probably benign
R1586:Alpi UTSW 1 87100201 missense probably damaging 1.00
R1835:Alpi UTSW 1 87099414 missense possibly damaging 0.88
R2372:Alpi UTSW 1 87100594 missense probably damaging 1.00
R4546:Alpi UTSW 1 87099117 missense probably damaging 1.00
R4861:Alpi UTSW 1 87100469 missense probably damaging 0.98
R4968:Alpi UTSW 1 87101525 missense probably benign 0.05
R5427:Alpi UTSW 1 87101354 missense probably benign 0.04
R6245:Alpi UTSW 1 87100834 missense probably damaging 1.00
R6394:Alpi UTSW 1 87100706 missense possibly damaging 0.71
R6398:Alpi UTSW 1 87099462 missense probably damaging 0.98
R6616:Alpi UTSW 1 87101114 missense possibly damaging 0.81
R7168:Alpi UTSW 1 87099433 missense possibly damaging 0.94
R7448:Alpi UTSW 1 87101535 start codon destroyed possibly damaging 0.79
R7473:Alpi UTSW 1 87099647 critical splice donor site probably null
R7527:Alpi UTSW 1 87098955 missense probably benign 0.01
R7552:Alpi UTSW 1 87099073 missense probably benign 0.00
R8008:Alpi UTSW 1 87098662 missense unknown
X0052:Alpi UTSW 1 87100201 missense probably damaging 1.00
X0057:Alpi UTSW 1 87101078 missense probably damaging 1.00
Z1176:Alpi UTSW 1 87099072 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACCATGTCTGTGGGTTATGC -3'
(R):5'- GTACCGTGCCAAGAAAGCAG -3'

Sequencing Primer
(F):5'- ACCATGTCTGTGGGTTATGCATCTC -3'
(R):5'- CAGGGTCACTGGATGATCTTCTATC -3'
Posted On2016-03-01