Incidental Mutation 'R4861:Gm26727'
ID374284
Institutional Source Beutler Lab
Gene Symbol Gm26727
Ensembl Gene ENSMUSG00000097112
Gene Namepredicted gene, 26727
Synonyms
MMRRC Submission 042472-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R4861 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location67432816-67433181 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67432945 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 79 (I79M)
Ref Sequence ENSEMBL: ENSMUSP00000137987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178898] [ENSMUST00000180773]
Predicted Effect probably benign
Transcript: ENSMUST00000178898
Predicted Effect probably damaging
Transcript: ENSMUST00000180773
AA Change: I79M

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137987
Gene: ENSMUSG00000097112
AA Change: I79M

DomainStartEndE-ValueType
transmembrane domain 10 29 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 87.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,245,905 R1153H probably damaging Het
Ahcy T C 2: 155,060,516 E411G probably benign Het
Alpi T A 1: 87,100,469 I211F probably damaging Het
Arfgef3 G A 10: 18,607,731 A1415V probably benign Het
Bora T C 14: 99,047,474 probably null Het
Car3 T C 3: 14,866,896 V109A probably damaging Het
Ccdc114 A G 7: 45,942,873 E359G probably damaging Het
Cdk13 A T 13: 17,766,586 V17D probably damaging Het
Cept1 A C 3: 106,505,732 S226A probably damaging Het
Dbt A T 3: 116,548,078 I443L probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Farp2 T C 1: 93,605,419 L633S probably damaging Het
Gm5800 T A 14: 51,716,047 N37I probably damaging Het
Hapln1 G A 13: 89,601,452 G39S possibly damaging Het
Ice2 T A 9: 69,415,448 S408R probably benign Het
Lctl T C 9: 64,119,763 I131T possibly damaging Het
Ncoa7 T A 10: 30,704,612 M117L probably benign Het
Npy4r C T 14: 34,146,883 W149* probably null Het
Nr5a2 A G 1: 136,948,720 probably null Het
Plg G A 17: 12,395,735 E301K probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Rapgef2 T C 3: 79,074,436 K1084R probably benign Het
Slc41a2 T C 10: 83,316,458 Q51R probably damaging Het
Slc47a2 A T 11: 61,336,233 C170S probably benign Het
Slco1b2 A T 6: 141,671,222 N427I possibly damaging Het
Smc2 G A 4: 52,461,090 R571H probably benign Het
Sp4 G T 12: 118,300,811 probably null Het
Tas2r117 T C 6: 132,803,129 F77L probably benign Het
Tbcd C T 11: 121,601,961 R875C probably damaging Het
Thumpd2 A G 17: 81,026,801 S453P probably benign Het
Vars2 G T 17: 35,661,933 Q13K probably benign Het
Other mutations in Gm26727
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4861:Gm26727 UTSW 2 67432945 missense probably damaging 0.99
R7139:Gm26727 UTSW 2 67433037 missense unknown
Predicted Primers PCR Primer
(F):5'- CAGCTATGACATGTTCTCATTCATGC -3'
(R):5'- TCAGAGAAGGGAAATATCTATCACG -3'

Sequencing Primer
(F):5'- ATGACATGTTCTCATTCATGCTTTGG -3'
(R):5'- GGGAAATATCTATCACGTTTTTGTCC -3'
Posted On2016-03-01