Incidental Mutation 'R4861:Car3'
ID374287
Institutional Source Beutler Lab
Gene Symbol Car3
Ensembl Gene ENSMUSG00000027559
Gene Namecarbonic anhydrase 3
SynonymsCar-3
MMRRC Submission 042472-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4861 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location14863512-14872523 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14866896 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 109 (V109A)
Ref Sequence ENSEMBL: ENSMUSP00000029076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029076]
Predicted Effect probably damaging
Transcript: ENSMUST00000029076
AA Change: V109A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029076
Gene: ENSMUSG00000027559
AA Change: V109A

DomainStartEndE-ValueType
Carb_anhydrase 5 259 2.72e-135 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195575
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195834
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 87.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Carbonic anhydrase III (CAIII) is a member of a multigene family (at least six separate genes are known) that encodes carbonic anhydrase isozymes. These carbonic anhydrases are a class of metalloenzymes that catalyze the reversible hydration of carbon dioxide and are differentially expressed in a number of cell types. The expression of the CA3 gene is strictly tissue specific and present at high levels in skeletal muscle and much lower levels in cardiac and smooth muscle. A proportion of carriers of Duchenne muscle dystrophy have a higher CA3 level than normal. The gene spans 10.3 kb and contains seven exons and six introns. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and exhibit a normal life span and a normal response to hyperoxic challenge. Mutant muscles display shorter half-relaxation times for both single and tetanic twitches but show normal fatigability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,245,905 R1153H probably damaging Het
Ahcy T C 2: 155,060,516 E411G probably benign Het
Alpi T A 1: 87,100,469 I211F probably damaging Het
Arfgef3 G A 10: 18,607,731 A1415V probably benign Het
Bora T C 14: 99,047,474 probably null Het
Ccdc114 A G 7: 45,942,873 E359G probably damaging Het
Cdk13 A T 13: 17,766,586 V17D probably damaging Het
Cept1 A C 3: 106,505,732 S226A probably damaging Het
Dbt A T 3: 116,548,078 I443L probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Farp2 T C 1: 93,605,419 L633S probably damaging Het
Gm26727 T C 2: 67,432,945 I79M probably damaging Het
Gm5800 T A 14: 51,716,047 N37I probably damaging Het
Hapln1 G A 13: 89,601,452 G39S possibly damaging Het
Ice2 T A 9: 69,415,448 S408R probably benign Het
Lctl T C 9: 64,119,763 I131T possibly damaging Het
Ncoa7 T A 10: 30,704,612 M117L probably benign Het
Npy4r C T 14: 34,146,883 W149* probably null Het
Nr5a2 A G 1: 136,948,720 probably null Het
Plg G A 17: 12,395,735 E301K probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Rapgef2 T C 3: 79,074,436 K1084R probably benign Het
Slc41a2 T C 10: 83,316,458 Q51R probably damaging Het
Slc47a2 A T 11: 61,336,233 C170S probably benign Het
Slco1b2 A T 6: 141,671,222 N427I possibly damaging Het
Smc2 G A 4: 52,461,090 R571H probably benign Het
Sp4 G T 12: 118,300,811 probably null Het
Tas2r117 T C 6: 132,803,129 F77L probably benign Het
Tbcd C T 11: 121,601,961 R875C probably damaging Het
Thumpd2 A G 17: 81,026,801 S453P probably benign Het
Vars2 G T 17: 35,661,933 Q13K probably benign Het
Other mutations in Car3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Car3 APN 3 14868379 missense probably benign 0.03
IGL02423:Car3 APN 3 14866851 missense probably damaging 1.00
R0624:Car3 UTSW 3 14866804 missense probably benign 0.16
R1775:Car3 UTSW 3 14864432 missense probably benign 0.01
R4861:Car3 UTSW 3 14866896 missense probably damaging 0.99
R5856:Car3 UTSW 3 14871641 missense probably damaging 1.00
R6273:Car3 UTSW 3 14871617 missense probably benign 0.14
R7481:Car3 UTSW 3 14863572 start codon destroyed probably benign 0.41
R7666:Car3 UTSW 3 14870064 missense probably benign
Z1177:Car3 UTSW 3 14871636 missense
Predicted Primers PCR Primer
(F):5'- GACATCTTTTATCCACAGAGTCATG -3'
(R):5'- AGGATGCTAACCCACTTGCC -3'

Sequencing Primer
(F):5'- CCACAGAGTCATGTTTCAAGACTTG -3'
(R):5'- GCCCACTTCTCTCTGACCTAG -3'
Posted On2016-03-01