Incidental Mutation 'R4861:Tas2r117'
ID374294
Institutional Source Beutler Lab
Gene Symbol Tas2r117
Ensembl Gene ENSMUSG00000058349
Gene Nametaste receptor, type 2, member 117
SynonymsTas2r17, T2R17, mt2r54, mGR17
MMRRC Submission 042472-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R4861 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location132802818-132803975 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 132803129 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 77 (F77L)
Ref Sequence ENSEMBL: ENSMUSP00000069768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068302]
Predicted Effect probably benign
Transcript: ENSMUST00000068302
AA Change: F77L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000069768
Gene: ENSMUSG00000058349
AA Change: F77L

DomainStartEndE-ValueType
Pfam:TAS2R 8 307 1.2e-85 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 87.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,245,905 R1153H probably damaging Het
Ahcy T C 2: 155,060,516 E411G probably benign Het
Alpi T A 1: 87,100,469 I211F probably damaging Het
Arfgef3 G A 10: 18,607,731 A1415V probably benign Het
Bora T C 14: 99,047,474 probably null Het
Car3 T C 3: 14,866,896 V109A probably damaging Het
Ccdc114 A G 7: 45,942,873 E359G probably damaging Het
Cdk13 A T 13: 17,766,586 V17D probably damaging Het
Cept1 A C 3: 106,505,732 S226A probably damaging Het
Dbt A T 3: 116,548,078 I443L probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Farp2 T C 1: 93,605,419 L633S probably damaging Het
Gm26727 T C 2: 67,432,945 I79M probably damaging Het
Gm5800 T A 14: 51,716,047 N37I probably damaging Het
Hapln1 G A 13: 89,601,452 G39S possibly damaging Het
Ice2 T A 9: 69,415,448 S408R probably benign Het
Lctl T C 9: 64,119,763 I131T possibly damaging Het
Ncoa7 T A 10: 30,704,612 M117L probably benign Het
Npy4r C T 14: 34,146,883 W149* probably null Het
Nr5a2 A G 1: 136,948,720 probably null Het
Plg G A 17: 12,395,735 E301K probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Rapgef2 T C 3: 79,074,436 K1084R probably benign Het
Slc41a2 T C 10: 83,316,458 Q51R probably damaging Het
Slc47a2 A T 11: 61,336,233 C170S probably benign Het
Slco1b2 A T 6: 141,671,222 N427I possibly damaging Het
Smc2 G A 4: 52,461,090 R571H probably benign Het
Sp4 G T 12: 118,300,811 probably null Het
Tbcd C T 11: 121,601,961 R875C probably damaging Het
Thumpd2 A G 17: 81,026,801 S453P probably benign Het
Vars2 G T 17: 35,661,933 Q13K probably benign Het
Other mutations in Tas2r117
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01611:Tas2r117 APN 6 132803484 missense probably benign 0.00
IGL01611:Tas2r117 APN 6 132803487 missense probably damaging 0.96
IGL02140:Tas2r117 APN 6 132803595 missense probably benign 0.15
IGL02154:Tas2r117 APN 6 132803715 missense probably benign 0.00
IGL02466:Tas2r117 APN 6 132803000 missense probably benign 0.12
IGL02942:Tas2r117 APN 6 132803694 missense probably benign 0.00
IGL03328:Tas2r117 APN 6 132803078 missense probably benign 0.40
PIT4480001:Tas2r117 UTSW 6 132803051 missense possibly damaging 0.91
R0380:Tas2r117 UTSW 6 132803588 nonsense probably null
R0456:Tas2r117 UTSW 6 132803391 missense probably benign 0.12
R0699:Tas2r117 UTSW 6 132803198 missense probably damaging 1.00
R2118:Tas2r117 UTSW 6 132803166 missense probably damaging 0.96
R2265:Tas2r117 UTSW 6 132803225 missense probably benign 0.06
R4420:Tas2r117 UTSW 6 132803349 nonsense probably null
R4861:Tas2r117 UTSW 6 132803129 missense probably benign 0.00
R5233:Tas2r117 UTSW 6 132803622 missense possibly damaging 0.95
R5384:Tas2r117 UTSW 6 132803154 missense probably benign 0.04
R6750:Tas2r117 UTSW 6 132802854 start gained probably benign
R6852:Tas2r117 UTSW 6 132802929 missense probably benign 0.00
R6902:Tas2r117 UTSW 6 132803325 missense probably damaging 0.98
R6946:Tas2r117 UTSW 6 132803325 missense probably damaging 0.98
R7129:Tas2r117 UTSW 6 132803387 missense probably benign 0.01
R7412:Tas2r117 UTSW 6 132803229 missense probably damaging 1.00
R7733:Tas2r117 UTSW 6 132803175 missense probably benign 0.02
R7768:Tas2r117 UTSW 6 132803522 missense probably damaging 1.00
R7953:Tas2r117 UTSW 6 132803318 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCTCCCAGAGCACACTTTCAG -3'
(R):5'- TCAGGAGGAGCAATGACACC -3'

Sequencing Primer
(F):5'- GCACACTTTCAGTCATTTTAATCGTG -3'
(R):5'- AACTGAAACTACTTTTTCAACTCTCC -3'
Posted On2016-03-01