Incidental Mutation 'R4861:Lctl'
ID374298
Institutional Source Beutler Lab
Gene Symbol Lctl
Ensembl Gene ENSMUSG00000032401
Gene Namelactase-like
SynonymsE130104I05Rik, KLPH
MMRRC Submission 042472-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R4861 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location64117147-64138118 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64119763 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 131 (I131T)
Ref Sequence ENSEMBL: ENSMUSP00000120815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034969] [ENSMUST00000118215] [ENSMUST00000124020]
Predicted Effect probably benign
Transcript: ENSMUST00000034969
AA Change: I131T

PolyPhen 2 Score 0.229 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000034969
Gene: ENSMUSG00000032401
AA Change: I131T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Glyco_hydro_1 32 502 1.7e-161 PFAM
transmembrane domain 540 562 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118215
SMART Domains Protein: ENSMUSP00000112979
Gene: ENSMUSG00000032401

DomainStartEndE-ValueType
Pfam:Glyco_hydro_1 1 343 5.8e-99 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000124020
AA Change: I131T

PolyPhen 2 Score 0.552 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000120815
Gene: ENSMUSG00000032401
AA Change: I131T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Glyco_hydro_1 32 235 2.3e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145011
Meta Mutation Damage Score 0.7978 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 87.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of family 1 glycosidases. Glycosidases are enzymes that hydrolyze glycosidic bonds and are classified into families based on primary amino acid sequence. Most members of family 1 have two conserved glutamic acid residues, which are required for enzymatic activity. The mouse ortholog of this protein has been characterized and has a domain structure of an N-terminal signal peptide, glycosidase domain, transmembrane domain, and a short cytoplasmic tail. It lacks one of the conserved glutamic acid residues important for catalysis, and its function remains to be determined (PMID: 12084582). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
PHENOTYPE: No notable phenotype was detected in a high-throughput screen of homozygous null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,245,905 R1153H probably damaging Het
Ahcy T C 2: 155,060,516 E411G probably benign Het
Alpi T A 1: 87,100,469 I211F probably damaging Het
Arfgef3 G A 10: 18,607,731 A1415V probably benign Het
Bora T C 14: 99,047,474 probably null Het
Car3 T C 3: 14,866,896 V109A probably damaging Het
Ccdc114 A G 7: 45,942,873 E359G probably damaging Het
Cdk13 A T 13: 17,766,586 V17D probably damaging Het
Cept1 A C 3: 106,505,732 S226A probably damaging Het
Dbt A T 3: 116,548,078 I443L probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Farp2 T C 1: 93,605,419 L633S probably damaging Het
Gm26727 T C 2: 67,432,945 I79M probably damaging Het
Gm5800 T A 14: 51,716,047 N37I probably damaging Het
Hapln1 G A 13: 89,601,452 G39S possibly damaging Het
Ice2 T A 9: 69,415,448 S408R probably benign Het
Ncoa7 T A 10: 30,704,612 M117L probably benign Het
Npy4r C T 14: 34,146,883 W149* probably null Het
Nr5a2 A G 1: 136,948,720 probably null Het
Plg G A 17: 12,395,735 E301K probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Rapgef2 T C 3: 79,074,436 K1084R probably benign Het
Slc41a2 T C 10: 83,316,458 Q51R probably damaging Het
Slc47a2 A T 11: 61,336,233 C170S probably benign Het
Slco1b2 A T 6: 141,671,222 N427I possibly damaging Het
Smc2 G A 4: 52,461,090 R571H probably benign Het
Sp4 G T 12: 118,300,811 probably null Het
Tas2r117 T C 6: 132,803,129 F77L probably benign Het
Tbcd C T 11: 121,601,961 R875C probably damaging Het
Thumpd2 A G 17: 81,026,801 S453P probably benign Het
Vars2 G T 17: 35,661,933 Q13K probably benign Het
Other mutations in Lctl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Lctl APN 9 64133129 nonsense probably null
IGL03066:Lctl APN 9 64117735 start codon destroyed probably null 0.66
IGL03302:Lctl APN 9 64134848 unclassified probably benign
R0077:Lctl UTSW 9 64122107 start codon destroyed probably null 0.64
R0137:Lctl UTSW 9 64117698 utr 5 prime probably benign
R0335:Lctl UTSW 9 64118887 missense probably benign 0.00
R0391:Lctl UTSW 9 64122314 splice site probably benign
R1740:Lctl UTSW 9 64133107 missense probably damaging 1.00
R1866:Lctl UTSW 9 64131721 missense probably damaging 1.00
R2160:Lctl UTSW 9 64117767 missense probably benign 0.02
R2867:Lctl UTSW 9 64137868 missense probably benign 0.23
R2867:Lctl UTSW 9 64137868 missense probably benign 0.23
R3605:Lctl UTSW 9 64133193 missense probably damaging 1.00
R3607:Lctl UTSW 9 64133193 missense probably damaging 1.00
R4585:Lctl UTSW 9 64131600 missense probably damaging 1.00
R4861:Lctl UTSW 9 64119763 missense possibly damaging 0.55
R5249:Lctl UTSW 9 64137914 missense probably benign
R7021:Lctl UTSW 9 64132793 splice site probably null
R7106:Lctl UTSW 9 64132837 missense probably benign 0.22
R7221:Lctl UTSW 9 64118935 nonsense probably null
R7265:Lctl UTSW 9 64126921 missense probably damaging 1.00
R7353:Lctl UTSW 9 64126967 missense probably damaging 1.00
R7501:Lctl UTSW 9 64131579 missense probably benign 0.00
R7615:Lctl UTSW 9 64122110 missense probably damaging 1.00
R7855:Lctl UTSW 9 64133216 missense possibly damaging 0.89
RF014:Lctl UTSW 9 64118930 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGATAACAGTCCCTCCCC -3'
(R):5'- AGTCAGACTCTAGGCTCTGG -3'

Sequencing Primer
(F):5'- TCAGTGTCAGGCAAGGGTGAC -3'
(R):5'- TGTTAGTCCTCACACCAG -3'
Posted On2016-03-01