Incidental Mutation 'R4861:Ncoa7'
ID374301
Institutional Source Beutler Lab
Gene Symbol Ncoa7
Ensembl Gene ENSMUSG00000039697
Gene Namenuclear receptor coactivator 7
Synonyms9030406N13Rik
MMRRC Submission 042472-MU
Accession Numbers

Genbank: NM_172495; MGI: 2444847

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4861 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location30628999-30803326 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30704612 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 117 (M117L)
Ref Sequence ENSEMBL: ENSMUSP00000150021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068567] [ENSMUST00000213836] [ENSMUST00000215725] [ENSMUST00000215740] [ENSMUST00000215926]
Predicted Effect probably benign
Transcript: ENSMUST00000068567
AA Change: M117L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000066741
Gene: ENSMUSG00000039697
AA Change: M117L

DomainStartEndE-ValueType
coiled coil region 1 32 N/A INTRINSIC
LysM 118 161 2.24e-7 SMART
low complexity region 165 176 N/A INTRINSIC
TLDc 781 943 2.86e-64 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213836
AA Change: M117L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215725
AA Change: M117L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215740
AA Change: M117L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215926
AA Change: M117L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect unknown
Transcript: ENSMUST00000217398
AA Change: M43L
Meta Mutation Damage Score 0.0770 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 87.7%
Validation Efficiency
Allele List at MGI

All alleles(108) : Gene trapped(108)

Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,245,905 R1153H probably damaging Het
Ahcy T C 2: 155,060,516 E411G probably benign Het
Alpi T A 1: 87,100,469 I211F probably damaging Het
Arfgef3 G A 10: 18,607,731 A1415V probably benign Het
Bora T C 14: 99,047,474 probably null Het
Car3 T C 3: 14,866,896 V109A probably damaging Het
Ccdc114 A G 7: 45,942,873 E359G probably damaging Het
Cdk13 A T 13: 17,766,586 V17D probably damaging Het
Cept1 A C 3: 106,505,732 S226A probably damaging Het
Dbt A T 3: 116,548,078 I443L probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Farp2 T C 1: 93,605,419 L633S probably damaging Het
Gm26727 T C 2: 67,432,945 I79M probably damaging Het
Gm5800 T A 14: 51,716,047 N37I probably damaging Het
Hapln1 G A 13: 89,601,452 G39S possibly damaging Het
Ice2 T A 9: 69,415,448 S408R probably benign Het
Lctl T C 9: 64,119,763 I131T possibly damaging Het
Npy4r C T 14: 34,146,883 W149* probably null Het
Nr5a2 A G 1: 136,948,720 probably null Het
Plg G A 17: 12,395,735 E301K probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Rapgef2 T C 3: 79,074,436 K1084R probably benign Het
Slc41a2 T C 10: 83,316,458 Q51R probably damaging Het
Slc47a2 A T 11: 61,336,233 C170S probably benign Het
Slco1b2 A T 6: 141,671,222 N427I possibly damaging Het
Smc2 G A 4: 52,461,090 R571H probably benign Het
Sp4 G T 12: 118,300,811 probably null Het
Tas2r117 T C 6: 132,803,129 F77L probably benign Het
Tbcd C T 11: 121,601,961 R875C probably damaging Het
Thumpd2 A G 17: 81,026,801 S453P probably benign Het
Vars2 G T 17: 35,661,933 Q13K probably benign Het
Other mutations in Ncoa7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01406:Ncoa7 APN 10 30690840 missense probably damaging 1.00
IGL01716:Ncoa7 APN 10 30662334 missense probably damaging 0.96
IGL02114:Ncoa7 APN 10 30662364 missense probably damaging 1.00
IGL02170:Ncoa7 APN 10 30689853 missense possibly damaging 0.94
IGL02436:Ncoa7 APN 10 30694147 missense probably damaging 1.00
IGL02499:Ncoa7 APN 10 30690889 missense probably benign 0.04
IGL02533:Ncoa7 APN 10 30690899 missense possibly damaging 0.87
IGL02533:Ncoa7 APN 10 30722785 missense probably damaging 1.00
IGL02590:Ncoa7 APN 10 30694163 missense probably damaging 1.00
IGL02657:Ncoa7 APN 10 30652976 missense probably damaging 1.00
IGL03065:Ncoa7 APN 10 30647997 missense probably damaging 1.00
IGL03088:Ncoa7 APN 10 30698125 splice site probably null
IGL03090:Ncoa7 APN 10 30662400 missense probably damaging 0.96
IGL03196:Ncoa7 APN 10 30647514 utr 3 prime probably benign
D6062:Ncoa7 UTSW 10 30722655 missense probably damaging 1.00
R0058:Ncoa7 UTSW 10 30647541 missense probably damaging 1.00
R0058:Ncoa7 UTSW 10 30647541 missense probably damaging 1.00
R0578:Ncoa7 UTSW 10 30701917 critical splice donor site probably null
R0729:Ncoa7 UTSW 10 30691579 missense probably benign 0.00
R1538:Ncoa7 UTSW 10 30694211 missense probably damaging 0.99
R1539:Ncoa7 UTSW 10 30771729 missense probably damaging 1.00
R1574:Ncoa7 UTSW 10 30694101 missense probably damaging 1.00
R1574:Ncoa7 UTSW 10 30694101 missense probably damaging 1.00
R1624:Ncoa7 UTSW 10 30704659 missense possibly damaging 0.87
R1639:Ncoa7 UTSW 10 30701992 missense probably damaging 1.00
R1655:Ncoa7 UTSW 10 30698245 critical splice acceptor site probably null
R1876:Ncoa7 UTSW 10 30698126 intron probably benign
R1885:Ncoa7 UTSW 10 30648452 missense possibly damaging 0.81
R1886:Ncoa7 UTSW 10 30648452 missense possibly damaging 0.81
R1887:Ncoa7 UTSW 10 30648452 missense possibly damaging 0.81
R1909:Ncoa7 UTSW 10 30689800 missense probably damaging 1.00
R1938:Ncoa7 UTSW 10 30698170 missense probably benign 0.02
R1965:Ncoa7 UTSW 10 30654430 nonsense probably null
R1978:Ncoa7 UTSW 10 30691299 missense probably benign
R2303:Ncoa7 UTSW 10 30654435 missense probably damaging 1.00
R3777:Ncoa7 UTSW 10 30689756 missense probably damaging 1.00
R3778:Ncoa7 UTSW 10 30689756 missense probably damaging 1.00
R4026:Ncoa7 UTSW 10 30722724 missense probably benign 0.02
R4230:Ncoa7 UTSW 10 30698257 splice site probably null
R4667:Ncoa7 UTSW 10 30690790 missense probably damaging 1.00
R4786:Ncoa7 UTSW 10 30655642 missense probably benign 0.28
R4809:Ncoa7 UTSW 10 30771762 missense possibly damaging 0.92
R4820:Ncoa7 UTSW 10 30648476 missense probably damaging 1.00
R4839:Ncoa7 UTSW 10 30722659 missense possibly damaging 0.93
R4861:Ncoa7 UTSW 10 30704612 missense probably benign
R5271:Ncoa7 UTSW 10 30722729 missense probably benign 0.02
R5384:Ncoa7 UTSW 10 30722817 missense probably benign 0.00
R5418:Ncoa7 UTSW 10 30648039 missense probably damaging 1.00
R5964:Ncoa7 UTSW 10 30704636 missense probably damaging 1.00
R6257:Ncoa7 UTSW 10 30694177 missense probably damaging 1.00
R6683:Ncoa7 UTSW 10 30771721 missense probably damaging 0.99
R6813:Ncoa7 UTSW 10 30696192 missense probably damaging 1.00
R6910:Ncoa7 UTSW 10 30694121 missense possibly damaging 0.89
R7123:Ncoa7 UTSW 10 30654439 missense probably benign 0.28
R7327:Ncoa7 UTSW 10 30689800 missense probably damaging 1.00
R7412:Ncoa7 UTSW 10 30722851 missense possibly damaging 0.94
R7638:Ncoa7 UTSW 10 30722798 missense probably benign 0.35
R7653:Ncoa7 UTSW 10 30694243 missense probably damaging 1.00
R7848:Ncoa7 UTSW 10 30648418 missense possibly damaging 0.82
R7861:Ncoa7 UTSW 10 30691060 missense probably benign 0.38
R8125:Ncoa7 UTSW 10 30694091 missense possibly damaging 0.80
R8198:Ncoa7 UTSW 10 30704668 missense probably benign 0.00
R8240:Ncoa7 UTSW 10 30691729 missense probably benign 0.45
R8509:Ncoa7 UTSW 10 30696052 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTTTCCACATAAAACAAAGGGA -3'
(R):5'- GCGTGTGTTCCATTTCTACCCA -3'

Sequencing Primer
(F):5'- GAAAAAGACATGACCTAAAATGTGTC -3'
(R):5'- CCATTGCCTATTTTCCTACTGATAC -3'
Posted On2016-03-01