Incidental Mutation 'R4861:Slc47a2'
ID374303
Institutional Source Beutler Lab
Gene Symbol Slc47a2
Ensembl Gene ENSMUSG00000069855
Gene Namesolute carrier family 47, member 2
Synonyms4933429E10Rik
MMRRC Submission 042472-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4861 (G1)
Quality Score206
Status Not validated
Chromosome11
Chromosomal Location61301631-61342860 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 61336233 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 170 (C170S)
Ref Sequence ENSEMBL: ENSMUSP00000120907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093029] [ENSMUST00000134423]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082784
Predicted Effect probably benign
Transcript: ENSMUST00000093029
AA Change: C170S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000090710
Gene: ENSMUSG00000069855
AA Change: C170S

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
Pfam:MatE 53 213 1.7e-35 PFAM
transmembrane domain 227 246 N/A INTRINSIC
Pfam:MatE 274 435 4e-34 PFAM
transmembrane domain 444 466 N/A INTRINSIC
transmembrane domain 545 567 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134423
AA Change: C170S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000120907
Gene: ENSMUSG00000069855
AA Change: C170S

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
Pfam:MatE 53 213 3.5e-32 PFAM
transmembrane domain 227 246 N/A INTRINSIC
Pfam:MatE 274 435 1.7e-36 PFAM
transmembrane domain 444 466 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147450
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 87.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,245,905 R1153H probably damaging Het
Ahcy T C 2: 155,060,516 E411G probably benign Het
Alpi T A 1: 87,100,469 I211F probably damaging Het
Arfgef3 G A 10: 18,607,731 A1415V probably benign Het
Bora T C 14: 99,047,474 probably null Het
Car3 T C 3: 14,866,896 V109A probably damaging Het
Ccdc114 A G 7: 45,942,873 E359G probably damaging Het
Cdk13 A T 13: 17,766,586 V17D probably damaging Het
Cept1 A C 3: 106,505,732 S226A probably damaging Het
Dbt A T 3: 116,548,078 I443L probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Farp2 T C 1: 93,605,419 L633S probably damaging Het
Gm26727 T C 2: 67,432,945 I79M probably damaging Het
Gm5800 T A 14: 51,716,047 N37I probably damaging Het
Hapln1 G A 13: 89,601,452 G39S possibly damaging Het
Ice2 T A 9: 69,415,448 S408R probably benign Het
Lctl T C 9: 64,119,763 I131T possibly damaging Het
Ncoa7 T A 10: 30,704,612 M117L probably benign Het
Npy4r C T 14: 34,146,883 W149* probably null Het
Nr5a2 A G 1: 136,948,720 probably null Het
Plg G A 17: 12,395,735 E301K probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Rapgef2 T C 3: 79,074,436 K1084R probably benign Het
Slc41a2 T C 10: 83,316,458 Q51R probably damaging Het
Slco1b2 A T 6: 141,671,222 N427I possibly damaging Het
Smc2 G A 4: 52,461,090 R571H probably benign Het
Sp4 G T 12: 118,300,811 probably null Het
Tas2r117 T C 6: 132,803,129 F77L probably benign Het
Tbcd C T 11: 121,601,961 R875C probably damaging Het
Thumpd2 A G 17: 81,026,801 S453P probably benign Het
Vars2 G T 17: 35,661,933 Q13K probably benign Het
Other mutations in Slc47a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Slc47a2 APN 11 61302233 missense probably benign 0.16
IGL01367:Slc47a2 APN 11 61329781 missense probably benign 0.03
IGL01681:Slc47a2 APN 11 61338040 missense probably damaging 1.00
IGL01874:Slc47a2 APN 11 61312859 critical splice acceptor site probably null
IGL02049:Slc47a2 APN 11 61342539 missense probably damaging 0.98
IGL02399:Slc47a2 APN 11 61302194 unclassified probably benign
IGL02481:Slc47a2 APN 11 61336241 missense possibly damaging 0.58
IGL02880:Slc47a2 APN 11 61307540 missense probably damaging 0.97
IGL03068:Slc47a2 APN 11 61303943 missense probably damaging 1.00
IGL03136:Slc47a2 APN 11 61310765 missense probably benign 0.00
IGL03236:Slc47a2 APN 11 61313679 missense probably damaging 1.00
IGL03286:Slc47a2 APN 11 61342467 missense possibly damaging 0.57
R0047:Slc47a2 UTSW 11 61336242 missense possibly damaging 0.90
R0047:Slc47a2 UTSW 11 61336242 missense possibly damaging 0.90
R0597:Slc47a2 UTSW 11 61309976 missense probably damaging 0.98
R0690:Slc47a2 UTSW 11 61342504 missense possibly damaging 0.62
R2042:Slc47a2 UTSW 11 61338082 missense probably benign 0.05
R2217:Slc47a2 UTSW 11 61313671 missense probably benign 0.00
R2218:Slc47a2 UTSW 11 61313671 missense probably benign 0.00
R2271:Slc47a2 UTSW 11 61328526 critical splice donor site probably null
R2272:Slc47a2 UTSW 11 61328526 critical splice donor site probably null
R4067:Slc47a2 UTSW 11 61303947 missense probably benign 0.00
R4861:Slc47a2 UTSW 11 61336233 missense probably benign 0.00
R4862:Slc47a2 UTSW 11 61313694 missense possibly damaging 0.69
R4985:Slc47a2 UTSW 11 61302233 missense probably benign
R5419:Slc47a2 UTSW 11 61307586 missense probably benign
R5593:Slc47a2 UTSW 11 61342660 missense probably benign 0.00
R7105:Slc47a2 UTSW 11 61342443 missense probably benign 0.07
R7358:Slc47a2 UTSW 11 61308873 missense possibly damaging 0.78
R7522:Slc47a2 UTSW 11 61302250 missense probably benign 0.14
Z1176:Slc47a2 UTSW 11 61325889 missense probably benign 0.28
Z1177:Slc47a2 UTSW 11 61328575 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTATGTAGACTTGAGAGGGAGG -3'
(R):5'- ACTGATGCAGACAGAGTGC -3'

Sequencing Primer
(F):5'- TATGTAGACTTGAGAGGGAGGGTTAC -3'
(R):5'- AGACAGAGTGCAGGTTTGGCTC -3'
Posted On2016-03-01