Incidental Mutation 'R4861:Hapln1'
ID374308
Institutional Source Beutler Lab
Gene Symbol Hapln1
Ensembl Gene ENSMUSG00000021613
Gene Namehyaluronan and proteoglycan link protein 1
Synonymslink protein, LP-1, CLP, cartilage linking protein 1, Crtl1l, Crtl1
MMRRC Submission 042472-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4861 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location89539796-89611652 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 89601452 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 39 (G39S)
Ref Sequence ENSEMBL: ENSMUSP00000022108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022108]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022108
AA Change: G39S

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000022108
Gene: ENSMUSG00000021613
AA Change: G39S

DomainStartEndE-ValueType
IGv 58 143 3.48e-12 SMART
LINK 159 256 7.26e-61 SMART
LINK 260 353 8.35e-52 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225678
Meta Mutation Damage Score 0.1648 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 87.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects in cartilage development and delayed bone formation with short limbs and craniofacial anomalies. Mutants usually die as neonates due to respiratory failure, but some survive and develop dwarfism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,245,905 R1153H probably damaging Het
Ahcy T C 2: 155,060,516 E411G probably benign Het
Alpi T A 1: 87,100,469 I211F probably damaging Het
Arfgef3 G A 10: 18,607,731 A1415V probably benign Het
Bora T C 14: 99,047,474 probably null Het
Car3 T C 3: 14,866,896 V109A probably damaging Het
Ccdc114 A G 7: 45,942,873 E359G probably damaging Het
Cdk13 A T 13: 17,766,586 V17D probably damaging Het
Cept1 A C 3: 106,505,732 S226A probably damaging Het
Dbt A T 3: 116,548,078 I443L probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Farp2 T C 1: 93,605,419 L633S probably damaging Het
Gm26727 T C 2: 67,432,945 I79M probably damaging Het
Gm5800 T A 14: 51,716,047 N37I probably damaging Het
Ice2 T A 9: 69,415,448 S408R probably benign Het
Lctl T C 9: 64,119,763 I131T possibly damaging Het
Ncoa7 T A 10: 30,704,612 M117L probably benign Het
Npy4r C T 14: 34,146,883 W149* probably null Het
Nr5a2 A G 1: 136,948,720 probably null Het
Plg G A 17: 12,395,735 E301K probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Rapgef2 T C 3: 79,074,436 K1084R probably benign Het
Slc41a2 T C 10: 83,316,458 Q51R probably damaging Het
Slc47a2 A T 11: 61,336,233 C170S probably benign Het
Slco1b2 A T 6: 141,671,222 N427I possibly damaging Het
Smc2 G A 4: 52,461,090 R571H probably benign Het
Sp4 G T 12: 118,300,811 probably null Het
Tas2r117 T C 6: 132,803,129 F77L probably benign Het
Tbcd C T 11: 121,601,961 R875C probably damaging Het
Thumpd2 A G 17: 81,026,801 S453P probably benign Het
Vars2 G T 17: 35,661,933 Q13K probably benign Het
Other mutations in Hapln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Hapln1 APN 13 89608142 missense probably benign 0.00
IGL00494:Hapln1 APN 13 89605471 missense probably benign 0.04
IGL01865:Hapln1 APN 13 89601665 missense probably damaging 1.00
IGL02706:Hapln1 APN 13 89605459 missense possibly damaging 0.86
IGL02990:Hapln1 APN 13 89601606 missense probably benign 0.03
R0033:Hapln1 UTSW 13 89601813 missense probably benign 0.20
R0058:Hapln1 UTSW 13 89607878 missense probably benign 0.17
R0058:Hapln1 UTSW 13 89607878 missense probably benign 0.17
R0127:Hapln1 UTSW 13 89607869 missense probably benign 0.22
R0519:Hapln1 UTSW 13 89584716 start gained probably benign
R3862:Hapln1 UTSW 13 89605299 nonsense probably null
R3982:Hapln1 UTSW 13 89605441 missense probably benign
R4717:Hapln1 UTSW 13 89605460 missense probably benign 0.11
R4861:Hapln1 UTSW 13 89601452 missense possibly damaging 0.65
R4862:Hapln1 UTSW 13 89601452 missense possibly damaging 0.65
R4899:Hapln1 UTSW 13 89601650 missense possibly damaging 0.90
R5402:Hapln1 UTSW 13 89605411 missense probably benign 0.07
R5629:Hapln1 UTSW 13 89601515 missense probably damaging 0.98
R6019:Hapln1 UTSW 13 89608100 missense probably benign 0.45
R7917:Hapln1 UTSW 13 89607878 missense probably benign 0.17
R7938:Hapln1 UTSW 13 89605228 missense probably damaging 0.99
R8312:Hapln1 UTSW 13 89601444 missense probably benign
R8345:Hapln1 UTSW 13 89584783 missense probably benign
Z1088:Hapln1 UTSW 13 89601498 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAGCTTTGTAGTGGCTTGC -3'
(R):5'- GACCTTGATAGCCTCCATAGG -3'

Sequencing Primer
(F):5'- TGTAGTGGCTTGCAGGTAAC -3'
(R):5'- CTTCTTGTGATAGCCCATGGAAACG -3'
Posted On2016-03-01