Incidental Mutation 'R4861:Npy4r'
ID374309
Institutional Source Beutler Lab
Gene Symbol Npy4r
Ensembl Gene ENSMUSG00000048337
Gene Nameneuropeptide Y receptor Y4
SynonymsNYYR-D, Y4, Ppyr1
MMRRC Submission 042472-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R4861 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location34143992-34152489 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 34146883 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 149 (W149*)
Ref Sequence ENSEMBL: ENSMUSP00000056576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052164]
Predicted Effect probably null
Transcript: ENSMUST00000052164
AA Change: W149*
SMART Domains Protein: ENSMUSP00000056576
Gene: ENSMUSG00000048337
AA Change: W149*

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 52 337 2.5e-6 PFAM
Pfam:7tm_1 58 322 1.6e-48 PFAM
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 87.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit decreased weight, increased drinking behavior, decreased food intake, aggression towards other mice, decreased white adipose tissue, and accelerated lobuloalveolar development during pregnancy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,245,905 R1153H probably damaging Het
Ahcy T C 2: 155,060,516 E411G probably benign Het
Alpi T A 1: 87,100,469 I211F probably damaging Het
Arfgef3 G A 10: 18,607,731 A1415V probably benign Het
Bora T C 14: 99,047,474 probably null Het
Car3 T C 3: 14,866,896 V109A probably damaging Het
Ccdc114 A G 7: 45,942,873 E359G probably damaging Het
Cdk13 A T 13: 17,766,586 V17D probably damaging Het
Cept1 A C 3: 106,505,732 S226A probably damaging Het
Dbt A T 3: 116,548,078 I443L probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Farp2 T C 1: 93,605,419 L633S probably damaging Het
Gm26727 T C 2: 67,432,945 I79M probably damaging Het
Gm5800 T A 14: 51,716,047 N37I probably damaging Het
Hapln1 G A 13: 89,601,452 G39S possibly damaging Het
Ice2 T A 9: 69,415,448 S408R probably benign Het
Lctl T C 9: 64,119,763 I131T possibly damaging Het
Ncoa7 T A 10: 30,704,612 M117L probably benign Het
Nr5a2 A G 1: 136,948,720 probably null Het
Plg G A 17: 12,395,735 E301K probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Rapgef2 T C 3: 79,074,436 K1084R probably benign Het
Slc41a2 T C 10: 83,316,458 Q51R probably damaging Het
Slc47a2 A T 11: 61,336,233 C170S probably benign Het
Slco1b2 A T 6: 141,671,222 N427I possibly damaging Het
Smc2 G A 4: 52,461,090 R571H probably benign Het
Sp4 G T 12: 118,300,811 probably null Het
Tas2r117 T C 6: 132,803,129 F77L probably benign Het
Tbcd C T 11: 121,601,961 R875C probably damaging Het
Thumpd2 A G 17: 81,026,801 S453P probably benign Het
Vars2 G T 17: 35,661,933 Q13K probably benign Het
Other mutations in Npy4r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Npy4r APN 14 34146657 missense possibly damaging 0.56
IGL01449:Npy4r APN 14 34146365 missense probably damaging 1.00
IGL01982:Npy4r APN 14 34147325 missense possibly damaging 0.73
IGL03126:Npy4r APN 14 34146333 missense probably benign 0.00
R0011:Npy4r UTSW 14 34146723 missense probably damaging 0.99
R0011:Npy4r UTSW 14 34146723 missense probably damaging 0.99
R0579:Npy4r UTSW 14 34146683 missense probably benign 0.16
R2012:Npy4r UTSW 14 34147197 missense possibly damaging 0.58
R3735:Npy4r UTSW 14 34147269 missense probably benign 0.00
R4093:Npy4r UTSW 14 34147141 missense probably benign 0.21
R4650:Npy4r UTSW 14 34146224 missense possibly damaging 0.55
R4861:Npy4r UTSW 14 34146883 nonsense probably null
R4953:Npy4r UTSW 14 34146480 missense probably damaging 1.00
R4963:Npy4r UTSW 14 34147016 missense probably damaging 1.00
R5387:Npy4r UTSW 14 34146983 missense probably benign 0.21
R5973:Npy4r UTSW 14 34146707 missense probably benign 0.00
R6948:Npy4r UTSW 14 34146774 missense probably benign
R7251:Npy4r UTSW 14 34146915 missense probably damaging 1.00
R8081:Npy4r UTSW 14 34146567 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGTGATCTGAAGACCAGGACAC -3'
(R):5'- AACCTACTCATTGCCAACCTGG -3'

Sequencing Primer
(F):5'- CAAAGCAGACGACCTTGTCTTC -3'
(R):5'- TCATGTGCCTCATCTGCCAAC -3'
Posted On2016-03-01