Incidental Mutation 'R4861:Gm5800'
ID374310
Institutional Source Beutler Lab
Gene Symbol Gm5800
Ensembl Gene ENSMUSG00000068506
Gene Namepredicted gene 5800
Synonyms
MMRRC Submission 042472-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R4861 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location51711643-51717183 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 51716047 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 37 (N37I)
Ref Sequence ENSEMBL: ENSMUSP00000093605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095916]
Predicted Effect probably damaging
Transcript: ENSMUST00000095916
AA Change: N37I

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000093605
Gene: ENSMUSG00000068506
AA Change: N37I

DomainStartEndE-ValueType
Pfam:Takusan 10 90 4.7e-28 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 87.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,245,905 R1153H probably damaging Het
Ahcy T C 2: 155,060,516 E411G probably benign Het
Alpi T A 1: 87,100,469 I211F probably damaging Het
Arfgef3 G A 10: 18,607,731 A1415V probably benign Het
Bora T C 14: 99,047,474 probably null Het
Car3 T C 3: 14,866,896 V109A probably damaging Het
Ccdc114 A G 7: 45,942,873 E359G probably damaging Het
Cdk13 A T 13: 17,766,586 V17D probably damaging Het
Cept1 A C 3: 106,505,732 S226A probably damaging Het
Dbt A T 3: 116,548,078 I443L probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Farp2 T C 1: 93,605,419 L633S probably damaging Het
Gm26727 T C 2: 67,432,945 I79M probably damaging Het
Hapln1 G A 13: 89,601,452 G39S possibly damaging Het
Ice2 T A 9: 69,415,448 S408R probably benign Het
Lctl T C 9: 64,119,763 I131T possibly damaging Het
Ncoa7 T A 10: 30,704,612 M117L probably benign Het
Npy4r C T 14: 34,146,883 W149* probably null Het
Nr5a2 A G 1: 136,948,720 probably null Het
Plg G A 17: 12,395,735 E301K probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Rapgef2 T C 3: 79,074,436 K1084R probably benign Het
Slc41a2 T C 10: 83,316,458 Q51R probably damaging Het
Slc47a2 A T 11: 61,336,233 C170S probably benign Het
Slco1b2 A T 6: 141,671,222 N427I possibly damaging Het
Smc2 G A 4: 52,461,090 R571H probably benign Het
Sp4 G T 12: 118,300,811 probably null Het
Tas2r117 T C 6: 132,803,129 F77L probably benign Het
Tbcd C T 11: 121,601,961 R875C probably damaging Het
Thumpd2 A G 17: 81,026,801 S453P probably benign Het
Vars2 G T 17: 35,661,933 Q13K probably benign Het
Other mutations in Gm5800
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00958:Gm5800 APN 14 51713812 missense possibly damaging 0.96
IGL03325:Gm5800 APN 14 51714526 missense probably benign
R0037:Gm5800 UTSW 14 51716148 splice site probably benign
R0597:Gm5800 UTSW 14 51716004 missense probably benign
R1577:Gm5800 UTSW 14 51714559 missense probably benign 0.05
R1834:Gm5800 UTSW 14 51716092 missense possibly damaging 0.85
R1934:Gm5800 UTSW 14 51711939 missense possibly damaging 0.96
R2169:Gm5800 UTSW 14 51713678 missense possibly damaging 0.53
R2180:Gm5800 UTSW 14 51715994 nonsense probably null
R4861:Gm5800 UTSW 14 51716047 missense probably damaging 0.98
R5267:Gm5800 UTSW 14 51713837 splice site probably null
R6545:Gm5800 UTSW 14 51711962 missense possibly damaging 0.73
R6634:Gm5800 UTSW 14 51716138 missense possibly damaging 0.73
R6925:Gm5800 UTSW 14 51713700 missense possibly damaging 0.76
R7632:Gm5800 UTSW 14 51716448 splice site probably null
Predicted Primers PCR Primer
(F):5'- ATGTGGACAGTCTGGAGCTG -3'
(R):5'- GCTTGAAGATAGCTTTCCTGC -3'

Sequencing Primer
(F):5'- ACAGTCTGGAGCTGTTGCATCC -3'
(R):5'- GAAGATAGCTTTCCTGCTCTTTCAGG -3'
Posted On2016-03-01