Incidental Mutation 'R4861:Plg'
ID374311
Institutional Source Beutler Lab
Gene Symbol Plg
Ensembl Gene ENSMUSG00000059481
Gene Nameplasminogen
SynonymsPg
MMRRC Submission 042472-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.257) question?
Stock #R4861 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location12378609-12419384 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 12395735 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 301 (E301K)
Ref Sequence ENSEMBL: ENSMUSP00000014578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014578]
Predicted Effect probably benign
Transcript: ENSMUST00000014578
AA Change: E301K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000014578
Gene: ENSMUSG00000059481
AA Change: E301K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PAN_AP 20 97 8.67e-14 SMART
KR 101 183 1.31e-41 SMART
KR 184 264 5.4e-43 SMART
KR 273 354 3.45e-50 SMART
KR 375 456 3.9e-49 SMART
KR 479 562 5.53e-40 SMART
Tryp_SPc 581 805 4.11e-94 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 87.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a secreted blood zymogen that is activated by proteolysis and converted to plasmin and angiostatin. Plasmin dissolves fibrin in blood clots and is an important protease in many other cellular processes while angiostatin inhibits angiogenesis. Defects in this gene are likely a cause of thrombophilia and ligneous conjunctivitis. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous null mutants exhibit retarded growth, variable rectal prolapse, impaired fertility and lactation in females, early mortality, and widespread fibrin deposition and thrombotic lesions in liver, lung, stomach and other tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,245,905 R1153H probably damaging Het
Ahcy T C 2: 155,060,516 E411G probably benign Het
Alpi T A 1: 87,100,469 I211F probably damaging Het
Arfgef3 G A 10: 18,607,731 A1415V probably benign Het
Bora T C 14: 99,047,474 probably null Het
Car3 T C 3: 14,866,896 V109A probably damaging Het
Ccdc114 A G 7: 45,942,873 E359G probably damaging Het
Cdk13 A T 13: 17,766,586 V17D probably damaging Het
Cept1 A C 3: 106,505,732 S226A probably damaging Het
Dbt A T 3: 116,548,078 I443L probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Farp2 T C 1: 93,605,419 L633S probably damaging Het
Gm26727 T C 2: 67,432,945 I79M probably damaging Het
Gm5800 T A 14: 51,716,047 N37I probably damaging Het
Hapln1 G A 13: 89,601,452 G39S possibly damaging Het
Ice2 T A 9: 69,415,448 S408R probably benign Het
Lctl T C 9: 64,119,763 I131T possibly damaging Het
Ncoa7 T A 10: 30,704,612 M117L probably benign Het
Npy4r C T 14: 34,146,883 W149* probably null Het
Nr5a2 A G 1: 136,948,720 probably null Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Rapgef2 T C 3: 79,074,436 K1084R probably benign Het
Slc41a2 T C 10: 83,316,458 Q51R probably damaging Het
Slc47a2 A T 11: 61,336,233 C170S probably benign Het
Slco1b2 A T 6: 141,671,222 N427I possibly damaging Het
Smc2 G A 4: 52,461,090 R571H probably benign Het
Sp4 G T 12: 118,300,811 probably null Het
Tas2r117 T C 6: 132,803,129 F77L probably benign Het
Tbcd C T 11: 121,601,961 R875C probably damaging Het
Thumpd2 A G 17: 81,026,801 S453P probably benign Het
Vars2 G T 17: 35,661,933 Q13K probably benign Het
Other mutations in Plg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Plg APN 17 12411493 missense probably damaging 1.00
IGL01128:Plg APN 17 12396699 splice site probably benign
IGL01522:Plg APN 17 12404069 missense probably damaging 1.00
IGL01981:Plg APN 17 12403047 splice site probably benign
IGL03338:Plg APN 17 12419072 missense probably damaging 1.00
R0391:Plg UTSW 17 12419081 missense probably damaging 1.00
R0531:Plg UTSW 17 12411447 splice site probably benign
R0646:Plg UTSW 17 12418736 missense probably damaging 1.00
R0759:Plg UTSW 17 12410951 missense probably damaging 1.00
R1013:Plg UTSW 17 12378721 splice site probably benign
R2116:Plg UTSW 17 12384477 missense probably damaging 0.99
R2442:Plg UTSW 17 12410960 missense probably benign 0.15
R2512:Plg UTSW 17 12403229 missense probably benign
R2879:Plg UTSW 17 12404100 missense possibly damaging 0.92
R3107:Plg UTSW 17 12384429 missense probably benign 0.00
R3405:Plg UTSW 17 12403209 missense possibly damaging 0.65
R4409:Plg UTSW 17 12390263 missense probably damaging 1.00
R4861:Plg UTSW 17 12395735 missense probably benign 0.00
R4977:Plg UTSW 17 12403089 missense probably damaging 1.00
R4990:Plg UTSW 17 12411510 missense probably benign
R5319:Plg UTSW 17 12403227 missense possibly damaging 0.49
R5443:Plg UTSW 17 12382183 missense probably benign 0.03
R5635:Plg UTSW 17 12395754 missense probably damaging 1.00
R5981:Plg UTSW 17 12378718 critical splice donor site probably null
R6166:Plg UTSW 17 12398114 missense probably damaging 0.99
R6688:Plg UTSW 17 12391845 missense probably damaging 1.00
R6726:Plg UTSW 17 12378708 missense probably damaging 1.00
R6995:Plg UTSW 17 12419051 missense probably benign 0.00
R7028:Plg UTSW 17 12391836 missense probably damaging 1.00
R7168:Plg UTSW 17 12388559 missense probably damaging 1.00
R7356:Plg UTSW 17 12410911 missense probably damaging 1.00
Z1176:Plg UTSW 17 12414185 missense probably benign 0.02
Z1177:Plg UTSW 17 12403233 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGAGAGACCCTGCCTTCATC -3'
(R):5'- CAGGTAAAACACTGCTGAATGTC -3'

Sequencing Primer
(F):5'- TTCCAAAACATCTGTTGGTGC -3'
(R):5'- AAAACACTGCTGAATGTCTCTTTCC -3'
Posted On2016-03-01