Mutagenetix > Incidental Mutation

Incidental Mutation 'R4837:Pikfyve'

374315

Institutional Source

Beutler Lab

Gene Symbol

Pikfyve

Ensembl Gene

ENSMUSG00000025949

Gene Name

phosphoinositide kinase, FYVE type zinc finger containing

Synonyms

Pip5k3

MMRRC Submission

042452-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4837 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

65186683-65278695 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 65246590 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 951 (E951G)

Ref Sequence

ENSEMBL: ENSMUSP00000079926 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707] [ENSMUST00000190058]

AlphaFold

Q9Z1T6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000081154
AA Change: E951G

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949
AA Change: E951G

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	161	230	5.95e-18	SMART
DEP	376	451	9.05e-27	SMART
Pfam:Cpn60_TCP1	547	822	2e-37	PFAM
low complexity region	1177	1189	N/A	INTRINSIC
low complexity region	1516	1536	N/A	INTRINSIC
PIPKc	1745	2039	3.03e-162	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000097707
AA Change: E996G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949
AA Change: E996G

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	150	219	5.95e-18	SMART
DEP	365	440	9.05e-27	SMART
Pfam:Cpn60_TCP1	590	864	1.8e-35	PFAM
low complexity region	1222	1234	N/A	INTRINSIC
low complexity region	1561	1581	N/A	INTRINSIC
PIPKc	1790	2084	3.03e-162	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000190058

SMART Domains

Protein: ENSMUSP00000140204
Gene: ENSMUSG00000025949

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC

Meta Mutation Damage Score

0.0594

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.9%

Validation Efficiency

99% (75/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]

Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	A	T	7: 120,246,980 (GRCm38)	H618L	probably benign	Het
Adgrl3	A	G	5: 81,766,234 (GRCm38)	T1230A	probably benign	Het
Ahnak2	A	G	12: 112,785,739 (GRCm38)	S203P	probably benign	Het
Allc	A	G	12: 28,559,309 (GRCm38)	V244A	probably benign	Het
Ap3m1	G	A	14: 21,037,157 (GRCm38)	P157L	probably damaging	Het
Arhgef2	T	G	3: 88,632,943 (GRCm38)	I97S	probably damaging	Het
Btaf1	C	A	19: 36,966,785 (GRCm38)	T398K	probably benign	Het
Cabp1	T	C	5: 115,173,153 (GRCm38)	M158V	probably damaging	Het
Ccdc162	G	A	10: 41,673,867 (GRCm38)	P340L	probably benign	Het
Ccdc168	G	A	1: 44,061,434 (GRCm38)	T168I	possibly damaging	Het
Clip4	A	G	17: 71,834,222 (GRCm38)	K524E	probably damaging	Het
Cltc	A	G	11: 86,695,648 (GRCm38)	V189A	probably benign	Het
Cmc2	A	G	8: 116,894,140 (GRCm38)	F34S	probably damaging	Het
Ctcfl	G	T	2: 173,113,656 (GRCm38)	T271N	probably benign	Het
Cyp4f16	T	A	17: 32,542,764 (GRCm38)	F124I	possibly damaging	Het
Ddx41	C	A	13: 55,531,648 (GRCm38)	R479L	possibly damaging	Het
Dgcr6	C	A	16: 18,066,846 (GRCm38)	N87K	possibly damaging	Het
Dll1	A	G	17: 15,368,859 (GRCm38)	L518P	probably damaging	Het
Dnaja4	G	T	9: 54,710,644 (GRCm38)	M263I	probably benign	Het
Dusp13b	T	A	14: 21,743,525 (GRCm38)		probably benign	Het
Fam185a	T	A	5: 21,480,377 (GRCm38)	I357N	probably benign	Het
Fam186a	T	C	15: 99,940,797 (GRCm38)	Y2522C	unknown	Het
Fam222a	T	A	5: 114,594,397 (GRCm38)	C4*	probably null	Het
Filip1	T	C	9: 79,819,459 (GRCm38)	D626G	probably damaging	Het
Ghrhr	C	T	6: 55,388,187 (GRCm38)	R389C	probably damaging	Het
Gstm3	T	A	3: 107,964,215 (GRCm38)	T217S	probably benign	Het
Gucy2g	T	C	19: 55,226,053 (GRCm38)	T548A	probably benign	Het
Hectd3	T	A	4: 117,002,597 (GRCm38)	C744S	probably null	Het
Hnrnpl	T	C	7: 28,817,337 (GRCm38)	S184P	probably benign	Het
Il3	G	A	11: 54,267,257 (GRCm38)		probably benign	Het
Itga5	C	T	15: 103,354,084 (GRCm38)	G330S	probably damaging	Het
Kl	A	G	5: 150,980,847 (GRCm38)	T355A	possibly damaging	Het
Lipk	A	C	19: 34,032,320 (GRCm38)	S208R	probably damaging	Het
Mrs2	T	A	13: 24,999,057 (GRCm38)		probably null	Het
Mutyh	A	G	4: 116,817,690 (GRCm38)	E372G	probably damaging	Het
Myh4	C	A	11: 67,258,992 (GRCm38)	A1821D	probably benign	Het
Nfkb2	G	T	19: 46,307,567 (GRCm38)	E170D	probably benign	Het
Nlrp12	T	C	7: 3,231,061 (GRCm38)	E881G	probably damaging	Het
Nol9	T	C	4: 152,052,095 (GRCm38)		probably benign	Het
Nwd1	A	G	8: 72,657,131 (GRCm38)	E52G	probably damaging	Het
Olfr1025-ps1	A	G	2: 85,918,404 (GRCm38)	T160A	probably benign	Het
Opn4	A	G	14: 34,596,304 (GRCm38)	V242A	probably damaging	Het
Or4e1	A	T	14: 52,463,646 (GRCm38)	M121K	probably damaging	Het
Or4k44	T	A	2: 111,537,974 (GRCm38)	H105L	probably damaging	Het
Or6b1	T	G	6: 42,837,849 (GRCm38)		probably null	Het
Or6b2b	A	G	1: 92,490,975 (GRCm38)	V260A	probably benign	Het
Paxbp1	G	A	16: 91,034,978 (GRCm38)	Q341*	probably null	Het
Pcdh7	T	C	5: 57,720,411 (GRCm38)	V436A	possibly damaging	Het
Pcdhb18	G	A	18: 37,489,814 (GRCm38)	V66M	probably damaging	Het
Plcg1	A	G	2: 160,750,986 (GRCm38)	N179S	probably benign	Het
Prr11	A	C	11: 87,098,691 (GRCm38)	S285A	probably benign	Het
Ranbp17	A	G	11: 33,328,451 (GRCm38)	S139P	probably damaging	Het
Rasa4	G	A	5: 136,091,810 (GRCm38)		probably null	Het
Rnf213	G	C	11: 119,442,763 (GRCm38)	G2934R	probably benign	Het
Rpap1	A	G	2: 119,778,251 (GRCm38)	V210A	probably benign	Het
Rpn1	T	A	6: 88,090,205 (GRCm38)	N182K	probably benign	Het
Rps24	C	T	14: 24,491,787 (GRCm38)	T14I	possibly damaging	Het
Rrp12	C	T	19: 41,877,505 (GRCm38)		probably null	Het
Rttn	T	A	18: 89,090,415 (GRCm38)		probably null	Het
Rufy1	A	G	11: 50,401,493 (GRCm38)	S490P	probably damaging	Het
Sec62	T	A	3: 30,809,869 (GRCm38)	M100K	unknown	Het
Spata16	A	G	3: 26,732,932 (GRCm38)	H253R	possibly damaging	Het
Srcap	T	C	7: 127,558,962 (GRCm38)		probably benign	Het
Srrm1	A	G	4: 135,345,512 (GRCm38)		probably benign	Het
Tbcd	G	A	11: 121,582,785 (GRCm38)		probably null	Het
Tedc2	C	A	17: 24,220,593 (GRCm38)	A25S	probably damaging	Het
Tnr	A	T	1: 159,684,788 (GRCm38)		probably benign	Het
Tnxb	A	C	17: 34,718,007 (GRCm38)	D3730A	probably damaging	Het
Tor2a	G	A	2: 32,760,597 (GRCm38)	G201D	probably damaging	Het
Tpp1	T	C	7: 105,746,649 (GRCm38)	T558A	probably benign	Het
Vmn1r211	G	T	13: 22,852,126 (GRCm38)	Q124K	probably benign	Het
Wasf3	T	C	5: 146,460,978 (GRCm38)	V185A	probably benign	Het
Zbtb12	A	G	17: 34,896,009 (GRCm38)	T257A	probably benign	Het

Other mutations in Pikfyve

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Pikfyve	APN	1	65,260,121 (GRCm38)	critical splice donor site	probably null
IGL01135:Pikfyve	APN	1	65,251,635 (GRCm38)	missense	probably damaging	0.96
IGL01511:Pikfyve	APN	1	65,258,869 (GRCm38)	nonsense	probably null
IGL01759:Pikfyve	APN	1	65,253,353 (GRCm38)	missense	probably benign	0.06
IGL01888:Pikfyve	APN	1	65,223,640 (GRCm38)	missense	probably damaging	1.00
IGL01967:Pikfyve	APN	1	65,264,365 (GRCm38)	missense	possibly damaging	0.89
IGL02055:Pikfyve	APN	1	65,238,544 (GRCm38)	critical splice donor site	probably null
IGL02119:Pikfyve	APN	1	65,272,571 (GRCm38)	missense	probably damaging	1.00
IGL02141:Pikfyve	APN	1	65,246,397 (GRCm38)	missense	probably benign	0.13
IGL02207:Pikfyve	APN	1	65,251,678 (GRCm38)	critical splice donor site	probably null
IGL02380:Pikfyve	APN	1	65,256,021 (GRCm38)	missense	probably damaging	0.99
IGL02400:Pikfyve	APN	1	65,252,569 (GRCm38)	missense	probably damaging	1.00
IGL02403:Pikfyve	APN	1	65,244,504 (GRCm38)	missense	probably damaging	0.99
IGL02426:Pikfyve	APN	1	65,251,612 (GRCm38)	missense	possibly damaging	0.77
IGL02496:Pikfyve	APN	1	65,264,376 (GRCm38)	missense	possibly damaging	0.94
IGL02573:Pikfyve	APN	1	65,230,855 (GRCm38)	critical splice donor site	probably null
IGL02746:Pikfyve	APN	1	65,234,272 (GRCm38)	missense	probably damaging	1.00
IGL02814:Pikfyve	APN	1	65,250,194 (GRCm38)	nonsense	probably null
IGL02890:Pikfyve	APN	1	65,230,797 (GRCm38)	missense	probably benign	0.00
IGL03102:Pikfyve	APN	1	65,252,467 (GRCm38)	nonsense	probably null
IGL03294:Pikfyve	APN	1	65,247,067 (GRCm38)	missense	probably damaging	1.00
falcon	UTSW	1	65,196,741 (GRCm38)	missense	probably damaging	1.00
oompa	UTSW	1	65,196,706 (GRCm38)	missense	probably damaging	1.00
wonka	UTSW	1	65,196,706 (GRCm38)	missense	probably damaging	1.00
G5538:Pikfyve	UTSW	1	65,202,916 (GRCm38)	missense	probably damaging	1.00
R0031:Pikfyve	UTSW	1	65,215,929 (GRCm38)	splice site	probably benign
R0196:Pikfyve	UTSW	1	65,256,072 (GRCm38)	missense	possibly damaging	0.92
R0212:Pikfyve	UTSW	1	65,262,905 (GRCm38)	missense	probably benign	0.41
R0319:Pikfyve	UTSW	1	65,246,331 (GRCm38)	missense	probably benign	0.01
R0332:Pikfyve	UTSW	1	65,264,399 (GRCm38)	missense	probably benign	0.02
R0389:Pikfyve	UTSW	1	65,196,706 (GRCm38)	missense	probably damaging	1.00
R0443:Pikfyve	UTSW	1	65,196,706 (GRCm38)	missense	probably damaging	1.00
R0503:Pikfyve	UTSW	1	65,219,899 (GRCm38)	missense	probably damaging	0.97
R0722:Pikfyve	UTSW	1	65,253,523 (GRCm38)	missense	probably damaging	0.99
R0906:Pikfyve	UTSW	1	65,253,397 (GRCm38)	missense	probably damaging	1.00
R0907:Pikfyve	UTSW	1	65,202,830 (GRCm38)	missense	possibly damaging	0.64
R0970:Pikfyve	UTSW	1	65,265,824 (GRCm38)	missense	probably damaging	0.99
R1188:Pikfyve	UTSW	1	65,246,959 (GRCm38)	missense	possibly damaging	0.46
R1412:Pikfyve	UTSW	1	65,202,830 (GRCm38)	missense	possibly damaging	0.64
R1421:Pikfyve	UTSW	1	65,271,311 (GRCm38)	missense	probably damaging	1.00
R1468:Pikfyve	UTSW	1	65,251,666 (GRCm38)	missense	probably damaging	0.98
R1468:Pikfyve	UTSW	1	65,251,666 (GRCm38)	missense	probably damaging	0.98
R1472:Pikfyve	UTSW	1	65,224,201 (GRCm38)	missense	probably damaging	0.96
R1478:Pikfyve	UTSW	1	65,262,977 (GRCm38)	critical splice donor site	probably null
R1501:Pikfyve	UTSW	1	65,265,284 (GRCm38)	missense	possibly damaging	0.84
R1757:Pikfyve	UTSW	1	65,252,548 (GRCm38)	missense	probably damaging	0.99
R1773:Pikfyve	UTSW	1	65,246,370 (GRCm38)	missense	probably benign
R1773:Pikfyve	UTSW	1	65,192,271 (GRCm38)	missense	probably damaging	0.99
R1795:Pikfyve	UTSW	1	65,252,557 (GRCm38)	missense	probably damaging	1.00
R1855:Pikfyve	UTSW	1	65,258,798 (GRCm38)	missense	probably benign	0.03
R1905:Pikfyve	UTSW	1	65,192,295 (GRCm38)	critical splice donor site	probably null
R1995:Pikfyve	UTSW	1	65,246,708 (GRCm38)	missense	probably damaging	1.00
R2034:Pikfyve	UTSW	1	65,222,357 (GRCm38)	missense	probably damaging	1.00
R2045:Pikfyve	UTSW	1	65,253,353 (GRCm38)	missense	probably benign	0.06
R2229:Pikfyve	UTSW	1	65,267,855 (GRCm38)	missense	probably damaging	1.00
R2295:Pikfyve	UTSW	1	65,246,676 (GRCm38)	missense	probably damaging	0.99
R2913:Pikfyve	UTSW	1	65,253,517 (GRCm38)	missense	probably damaging	1.00
R3818:Pikfyve	UTSW	1	65,245,758 (GRCm38)	missense	probably damaging	1.00
R3832:Pikfyve	UTSW	1	65,244,420 (GRCm38)	missense	probably damaging	0.99
R3850:Pikfyve	UTSW	1	65,230,845 (GRCm38)	missense	probably damaging	1.00
R3946:Pikfyve	UTSW	1	65,196,681 (GRCm38)	missense	probably damaging	1.00
R4105:Pikfyve	UTSW	1	65,190,520 (GRCm38)	unclassified	probably benign
R4542:Pikfyve	UTSW	1	65,244,430 (GRCm38)	missense	probably damaging	1.00
R4574:Pikfyve	UTSW	1	65,192,192 (GRCm38)	missense	probably damaging	1.00
R4601:Pikfyve	UTSW	1	65,234,262 (GRCm38)	missense	probably damaging	1.00
R4667:Pikfyve	UTSW	1	65,250,273 (GRCm38)	missense	probably damaging	1.00
R4668:Pikfyve	UTSW	1	65,250,273 (GRCm38)	missense	probably damaging	1.00
R4669:Pikfyve	UTSW	1	65,250,273 (GRCm38)	missense	probably damaging	1.00
R4707:Pikfyve	UTSW	1	65,267,846 (GRCm38)	missense	probably benign
R4716:Pikfyve	UTSW	1	65,246,476 (GRCm38)	missense	possibly damaging	0.84
R4758:Pikfyve	UTSW	1	65,272,515 (GRCm38)	missense	possibly damaging	0.84
R4784:Pikfyve	UTSW	1	65,267,846 (GRCm38)	missense	probably benign
R4785:Pikfyve	UTSW	1	65,267,846 (GRCm38)	missense	probably benign
R4805:Pikfyve	UTSW	1	65,268,800 (GRCm38)	missense	probably damaging	0.99
R4831:Pikfyve	UTSW	1	65,196,741 (GRCm38)	missense	probably damaging	1.00
R5064:Pikfyve	UTSW	1	65,253,407 (GRCm38)	missense	probably damaging	1.00
R5115:Pikfyve	UTSW	1	65,224,117 (GRCm38)	intron	probably benign
R5265:Pikfyve	UTSW	1	65,267,829 (GRCm38)	missense	possibly damaging	0.72
R5279:Pikfyve	UTSW	1	65,196,699 (GRCm38)	nonsense	probably null
R5384:Pikfyve	UTSW	1	65,244,409 (GRCm38)	missense	probably damaging	1.00
R5387:Pikfyve	UTSW	1	65,265,268 (GRCm38)	missense	possibly damaging	0.94
R5461:Pikfyve	UTSW	1	65,235,033 (GRCm38)	missense	probably damaging	1.00
R5467:Pikfyve	UTSW	1	65,252,495 (GRCm38)	missense	probably damaging	1.00
R5560:Pikfyve	UTSW	1	65,253,407 (GRCm38)	missense	probably damaging	1.00
R5575:Pikfyve	UTSW	1	65,273,730 (GRCm38)	missense	probably damaging	1.00
R5611:Pikfyve	UTSW	1	65,256,088 (GRCm38)	missense	probably damaging	0.96
R5663:Pikfyve	UTSW	1	65,216,028 (GRCm38)	missense	probably benign	0.09
R5891:Pikfyve	UTSW	1	65,202,737 (GRCm38)	missense	probably damaging	1.00
R5960:Pikfyve	UTSW	1	65,253,438 (GRCm38)	nonsense	probably null
R6026:Pikfyve	UTSW	1	65,272,697 (GRCm38)	missense	probably damaging	1.00
R6057:Pikfyve	UTSW	1	65,272,571 (GRCm38)	missense	probably damaging	1.00
R6101:Pikfyve	UTSW	1	65,264,345 (GRCm38)	critical splice acceptor site	probably null
R6105:Pikfyve	UTSW	1	65,264,345 (GRCm38)	critical splice acceptor site	probably null
R6161:Pikfyve	UTSW	1	65,216,043 (GRCm38)	missense	probably benign	0.36
R6287:Pikfyve	UTSW	1	65,253,532 (GRCm38)	critical splice donor site	probably null
R6290:Pikfyve	UTSW	1	65,202,925 (GRCm38)	critical splice donor site	probably null
R6296:Pikfyve	UTSW	1	65,262,953 (GRCm38)	missense	probably damaging	0.99
R6516:Pikfyve	UTSW	1	65,265,781 (GRCm38)	missense	probably benign	0.35
R6835:Pikfyve	UTSW	1	65,258,843 (GRCm38)	missense	probably damaging	0.98
R6994:Pikfyve	UTSW	1	65,252,530 (GRCm38)	missense	probably damaging	1.00
R6997:Pikfyve	UTSW	1	65,246,663 (GRCm38)	missense	probably damaging	1.00
R7038:Pikfyve	UTSW	1	65,234,361 (GRCm38)	missense	probably damaging	1.00
R7044:Pikfyve	UTSW	1	65,246,854 (GRCm38)	missense	probably benign	0.01
R7057:Pikfyve	UTSW	1	65,247,205 (GRCm38)	missense	probably benign	0.00
R7525:Pikfyve	UTSW	1	65,244,426 (GRCm38)	nonsense	probably null
R7558:Pikfyve	UTSW	1	65,272,623 (GRCm38)	missense	probably benign	0.01
R7625:Pikfyve	UTSW	1	65,267,877 (GRCm38)	missense	possibly damaging	0.86
R7807:Pikfyve	UTSW	1	65,269,942 (GRCm38)	missense	probably damaging	1.00
R7961:Pikfyve	UTSW	1	65,255,134 (GRCm38)	missense	probably damaging	1.00
R8009:Pikfyve	UTSW	1	65,255,134 (GRCm38)	missense	probably damaging	1.00
R8154:Pikfyve	UTSW	1	65,265,789 (GRCm38)	missense	probably damaging	1.00
R8192:Pikfyve	UTSW	1	65,246,395 (GRCm38)	missense	possibly damaging	0.93
R8275:Pikfyve	UTSW	1	65,253,342 (GRCm38)	splice site	probably benign
R8307:Pikfyve	UTSW	1	65,245,735 (GRCm38)	missense	possibly damaging	0.77
R8710:Pikfyve	UTSW	1	65,215,996 (GRCm38)	missense	possibly damaging	0.94
R8867:Pikfyve	UTSW	1	65,244,417 (GRCm38)	missense	probably damaging	1.00
R8936:Pikfyve	UTSW	1	65,271,268 (GRCm38)	missense	possibly damaging	0.84
R8940:Pikfyve	UTSW	1	65,246,970 (GRCm38)	missense	probably benign	0.00
R8995:Pikfyve	UTSW	1	65,205,587 (GRCm38)	critical splice acceptor site	probably null
R9092:Pikfyve	UTSW	1	65,244,400 (GRCm38)	missense	probably damaging	1.00
R9131:Pikfyve	UTSW	1	65,246,080 (GRCm38)	missense	probably damaging	1.00
R9151:Pikfyve	UTSW	1	65,196,739 (GRCm38)	missense	probably damaging	1.00
R9210:Pikfyve	UTSW	1	65,252,560 (GRCm38)	missense	probably damaging	1.00
R9212:Pikfyve	UTSW	1	65,252,560 (GRCm38)	missense	probably damaging	1.00
R9235:Pikfyve	UTSW	1	65,260,029 (GRCm38)	missense	probably benign	0.37
R9368:Pikfyve	UTSW	1	65,268,742 (GRCm38)	missense	probably damaging	1.00
R9489:Pikfyve	UTSW	1	65,264,402 (GRCm38)	missense	probably benign
R9605:Pikfyve	UTSW	1	65,264,402 (GRCm38)	missense	probably benign
R9686:Pikfyve	UTSW	1	65,252,456 (GRCm38)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTTGGAATCAAGGACTGTGC -3'
(R):5'- GGTTCACGGAATGTAATAACTGGAG -3'

Sequencing Primer
(F):5'- TTGGAATCAAGGACTGTGCTAGAG -3'
(R):5'- CTGGAGAGATACAGAGGATTACATC -3'

Posted On

2016-03-01