Incidental Mutation 'R0178:Gdf10'
ID37432
Institutional Source Beutler Lab
Gene Symbol Gdf10
Ensembl Gene ENSMUSG00000021943
Gene Namegrowth differentiation factor 10
Synonyms
MMRRC Submission 038446-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0178 (G1)
Quality Score139
Status Validated (trace)
Chromosome14
Chromosomal Location33923587-33937983 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33924101 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 69 (D69G)
Ref Sequence ENSEMBL: ENSMUSP00000128621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168727]
Predicted Effect probably damaging
Transcript: ENSMUST00000168727
AA Change: D69G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128621
Gene: ENSMUSG00000021943
AA Change: D69G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 56 67 N/A INTRINSIC
TGFB 374 476 1e-50 SMART
Meta Mutation Damage Score 0.2896 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 88.8%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein has been shown to promote neural repair after stroke and may act as a tumor suppressor. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for disruption of this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik A G 11: 85,178,438 H94R probably benign Het
4922502D21Rik T C 6: 129,326,823 R60G probably benign Het
4930596D02Rik T G 14: 35,811,478 N111T probably benign Het
9930021J03Rik A G 19: 29,754,788 S342P probably damaging Het
Abca1 T C 4: 53,081,953 D769G possibly damaging Het
Adcy6 G T 15: 98,604,215 Q173K probably benign Het
Amotl1 G A 9: 14,548,773 A890V probably benign Het
Arfgap2 C T 2: 91,267,361 A141V probably benign Het
Asb2 G A 12: 103,325,552 P324L probably damaging Het
Cacna1g G A 11: 94,463,483 T202I probably damaging Het
Capn5 A G 7: 98,132,891 L214P probably damaging Het
Cdh20 A T 1: 104,975,051 D489V possibly damaging Het
Cers5 C A 15: 99,747,024 probably benign Het
Chrnb3 T A 8: 27,393,364 V111D probably damaging Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cyp2r1 T C 7: 114,550,408 E248G probably damaging Het
Dnmt3b A G 2: 153,675,018 T536A probably benign Het
Eef2 G A 10: 81,180,292 V496M possibly damaging Het
Fam118a T C 15: 85,045,880 probably benign Het
Fer1l6 T A 15: 58,637,914 probably null Het
Fhad1 A C 4: 141,955,340 F497V probably benign Het
Gbe1 G A 16: 70,478,386 G358D probably damaging Het
Ggt6 A G 11: 72,436,818 H150R possibly damaging Het
Gm1966 A T 7: 106,601,821 Y739N probably damaging Het
Gm45713 A T 7: 45,134,458 L110Q probably damaging Het
Gm9847 T C 12: 14,494,648 noncoding transcript Het
Grwd1 T C 7: 45,830,630 E51G probably damaging Het
H13 A G 2: 152,681,067 Y100C probably damaging Het
Kcne1 A C 16: 92,348,809 M49R probably damaging Het
Kcnma1 C T 14: 23,526,767 R236H probably damaging Het
Knl1 T A 2: 119,058,405 probably benign Het
Krt40 T C 11: 99,541,739 I150M probably damaging Het
Ldb2 A T 5: 44,473,499 V300E probably damaging Het
Lrp1b A T 2: 40,725,907 C3606S probably damaging Het
Lrrc42 A G 4: 107,247,720 I16T probably damaging Het
Lrrc6 A C 15: 66,454,101 D208E probably benign Het
Mtus1 G T 8: 41,002,361 L87I possibly damaging Het
Myot T C 18: 44,336,986 F10S probably damaging Het
Nrg3 A T 14: 38,376,456 H480Q probably damaging Het
Olfr205 A T 16: 59,329,420 F30I probably damaging Het
Olfr691 G A 7: 105,336,922 R265C probably benign Het
Prl2c5 A T 13: 13,191,805 D220V probably damaging Het
Rbm17 G A 2: 11,587,779 S295L probably benign Het
Serpina6 A G 12: 103,646,913 I376T probably damaging Het
Sh2d2a A T 3: 87,849,423 T192S probably benign Het
Slc27a1 T C 8: 71,584,462 Y417H possibly damaging Het
Slc6a1 T G 6: 114,304,852 I32S possibly damaging Het
Sntb1 T C 15: 55,906,144 T150A probably damaging Het
Tanc1 T A 2: 59,835,447 C1183* probably null Het
Tmprss7 C A 16: 45,690,843 W57C probably damaging Het
Ubac1 A T 2: 26,021,428 V36E possibly damaging Het
Zfc3h1 T C 10: 115,406,725 probably benign Het
Zfp644 C T 5: 106,636,905 C592Y probably damaging Het
Other mutations in Gdf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02558:Gdf10 APN 14 33923980 missense probably benign
IGL03203:Gdf10 APN 14 33934473 missense possibly damaging 0.94
R0890:Gdf10 UTSW 14 33932156 missense possibly damaging 0.57
R1218:Gdf10 UTSW 14 33932753 missense probably benign 0.01
R1219:Gdf10 UTSW 14 33932753 missense probably benign 0.01
R1221:Gdf10 UTSW 14 33932753 missense probably benign 0.01
R1670:Gdf10 UTSW 14 33932043 missense possibly damaging 0.92
R1956:Gdf10 UTSW 14 33932753 missense probably benign 0.01
R1957:Gdf10 UTSW 14 33932753 missense probably benign 0.01
R1958:Gdf10 UTSW 14 33932753 missense probably benign 0.01
R2154:Gdf10 UTSW 14 33934389 missense probably damaging 0.99
R2260:Gdf10 UTSW 14 33932277 missense probably damaging 1.00
R2971:Gdf10 UTSW 14 33924191 missense probably damaging 1.00
R3896:Gdf10 UTSW 14 33934481 missense probably damaging 1.00
R4027:Gdf10 UTSW 14 33932615 missense probably damaging 1.00
R4393:Gdf10 UTSW 14 33932738 missense probably damaging 1.00
R4782:Gdf10 UTSW 14 33931913 missense probably benign 0.00
R5436:Gdf10 UTSW 14 33932256 missense probably damaging 0.97
R5829:Gdf10 UTSW 14 33932717 missense probably damaging 0.99
R6387:Gdf10 UTSW 14 33924004 missense probably benign 0.05
R8346:Gdf10 UTSW 14 33931845 missense probably benign 0.00
Z1088:Gdf10 UTSW 14 33932390 missense probably damaging 1.00
Z1176:Gdf10 UTSW 14 33932532 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TGCTACAGAGAGCCAATCCCGATAC -3'
(R):5'- GCCCATCTCCATTCTGTGCCTAAAG -3'

Sequencing Primer
(F):5'- CCTGCTCGGATCAGCTTG -3'
(R):5'- GTCCCAACTGCAAGCTCTG -3'
Posted On2013-05-13