Incidental Mutation 'R4837:Srcap'
ID374344
Institutional Source Beutler Lab
Gene Symbol Srcap
Ensembl Gene ENSMUSG00000053877
Gene NameSnf2-related CREBBP activator protein
SynonymsD030022P06Rik, F630004O05Rik, B930091H02Rik
MMRRC Submission 042452-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R4837 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location127511983-127561219 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 127558962 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000084563] [ENSMUST00000186954] [ENSMUST00000187040] [ENSMUST00000189629] [ENSMUST00000190278] [ENSMUST00000190390]
Predicted Effect probably benign
Transcript: ENSMUST00000084563
SMART Domains Protein: ENSMUSP00000081611
Gene: ENSMUSG00000106715

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
AT_hook 62 74 4.04e0 SMART
low complexity region 114 134 N/A INTRINSIC
AT_hook 142 154 4.46e-1 SMART
low complexity region 155 166 N/A INTRINSIC
low complexity region 175 202 N/A INTRINSIC
AT_hook 206 218 3.94e-1 SMART
low complexity region 251 262 N/A INTRINSIC
low complexity region 263 273 N/A INTRINSIC
low complexity region 360 396 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000186954
AA Change: V2513A
SMART Domains Protein: ENSMUSP00000139536
Gene: ENSMUSG00000053877
AA Change: V2513A

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
HSA 125 196 5.4e-25 SMART
low complexity region 257 280 N/A INTRINSIC
low complexity region 283 310 N/A INTRINSIC
low complexity region 322 347 N/A INTRINSIC
low complexity region 396 420 N/A INTRINSIC
low complexity region 480 558 N/A INTRINSIC
low complexity region 577 592 N/A INTRINSIC
DEXDc 626 818 5e-37 SMART
low complexity region 993 1001 N/A INTRINSIC
low complexity region 1027 1042 N/A INTRINSIC
low complexity region 1046 1063 N/A INTRINSIC
low complexity region 1175 1194 N/A INTRINSIC
internal_repeat_1 1202 1245 2.24e-5 PROSPERO
low complexity region 1274 1302 N/A INTRINSIC
low complexity region 1304 1318 N/A INTRINSIC
low complexity region 1335 1353 N/A INTRINSIC
low complexity region 1355 1370 N/A INTRINSIC
low complexity region 1414 1441 N/A INTRINSIC
low complexity region 1452 1466 N/A INTRINSIC
low complexity region 1504 1533 N/A INTRINSIC
internal_repeat_1 1536 1579 2.24e-5 PROSPERO
internal_repeat_2 1537 1559 5.66e-5 PROSPERO
internal_repeat_2 1569 1589 5.66e-5 PROSPERO
low complexity region 1590 1607 N/A INTRINSIC
low complexity region 1609 1627 N/A INTRINSIC
low complexity region 1644 1678 N/A INTRINSIC
low complexity region 1713 1726 N/A INTRINSIC
low complexity region 1828 1840 N/A INTRINSIC
HELICc 1916 1999 1.2e-28 SMART
low complexity region 2058 2078 N/A INTRINSIC
coiled coil region 2166 2201 N/A INTRINSIC
low complexity region 2282 2348 N/A INTRINSIC
low complexity region 2374 2409 N/A INTRINSIC
low complexity region 2588 2600 N/A INTRINSIC
low complexity region 2642 2657 N/A INTRINSIC
low complexity region 2685 2712 N/A INTRINSIC
AT_hook 2745 2757 2.4e-2 SMART
low complexity region 2797 2817 N/A INTRINSIC
AT_hook 2825 2837 2.6e-3 SMART
low complexity region 2838 2849 N/A INTRINSIC
low complexity region 2858 2885 N/A INTRINSIC
AT_hook 2889 2901 2.4e-3 SMART
low complexity region 2934 2945 N/A INTRINSIC
low complexity region 2946 2956 N/A INTRINSIC
low complexity region 3043 3079 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000187040
AA Change: V2670A
SMART Domains Protein: ENSMUSP00000140036
Gene: ENSMUSG00000053877
AA Change: V2670A

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
HSA 125 196 5.4e-25 SMART
low complexity region 257 280 N/A INTRINSIC
low complexity region 283 310 N/A INTRINSIC
low complexity region 322 347 N/A INTRINSIC
low complexity region 396 420 N/A INTRINSIC
low complexity region 480 558 N/A INTRINSIC
low complexity region 577 592 N/A INTRINSIC
DEXDc 626 818 5e-37 SMART
low complexity region 993 1001 N/A INTRINSIC
low complexity region 1027 1042 N/A INTRINSIC
low complexity region 1046 1063 N/A INTRINSIC
low complexity region 1120 1143 N/A INTRINSIC
low complexity region 1150 1178 N/A INTRINSIC
low complexity region 1277 1305 N/A INTRINSIC
low complexity region 1332 1351 N/A INTRINSIC
internal_repeat_1 1359 1402 1.78e-5 PROSPERO
low complexity region 1431 1459 N/A INTRINSIC
low complexity region 1461 1475 N/A INTRINSIC
low complexity region 1492 1510 N/A INTRINSIC
low complexity region 1512 1527 N/A INTRINSIC
low complexity region 1571 1598 N/A INTRINSIC
low complexity region 1609 1623 N/A INTRINSIC
low complexity region 1661 1690 N/A INTRINSIC
internal_repeat_1 1693 1736 1.78e-5 PROSPERO
internal_repeat_2 1694 1716 4.56e-5 PROSPERO
internal_repeat_2 1726 1746 4.56e-5 PROSPERO
low complexity region 1747 1764 N/A INTRINSIC
low complexity region 1766 1784 N/A INTRINSIC
low complexity region 1801 1835 N/A INTRINSIC
low complexity region 1870 1883 N/A INTRINSIC
low complexity region 1985 1997 N/A INTRINSIC
HELICc 2073 2156 1.2e-28 SMART
low complexity region 2215 2235 N/A INTRINSIC
coiled coil region 2323 2358 N/A INTRINSIC
low complexity region 2439 2505 N/A INTRINSIC
low complexity region 2531 2566 N/A INTRINSIC
low complexity region 2745 2757 N/A INTRINSIC
low complexity region 2799 2814 N/A INTRINSIC
low complexity region 2842 2869 N/A INTRINSIC
AT_hook 2902 2914 2.4e-2 SMART
low complexity region 2954 2974 N/A INTRINSIC
AT_hook 2982 2994 2.6e-3 SMART
low complexity region 2995 3006 N/A INTRINSIC
low complexity region 3015 3042 N/A INTRINSIC
AT_hook 3046 3058 2.4e-3 SMART
low complexity region 3091 3102 N/A INTRINSIC
low complexity region 3103 3113 N/A INTRINSIC
low complexity region 3200 3236 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000189629
AA Change: V2494A
SMART Domains Protein: ENSMUSP00000139644
Gene: ENSMUSG00000107023
AA Change: V2494A

DomainStartEndE-ValueType
low complexity region 7 29 N/A INTRINSIC
HSA 106 177 5.4e-25 SMART
low complexity region 238 261 N/A INTRINSIC
low complexity region 264 291 N/A INTRINSIC
low complexity region 303 328 N/A INTRINSIC
low complexity region 377 401 N/A INTRINSIC
low complexity region 461 539 N/A INTRINSIC
low complexity region 558 573 N/A INTRINSIC
DEXDc 607 799 5e-37 SMART
low complexity region 974 982 N/A INTRINSIC
low complexity region 1008 1023 N/A INTRINSIC
low complexity region 1027 1044 N/A INTRINSIC
low complexity region 1156 1175 N/A INTRINSIC
internal_repeat_1 1183 1226 2e-5 PROSPERO
low complexity region 1255 1283 N/A INTRINSIC
low complexity region 1285 1299 N/A INTRINSIC
low complexity region 1316 1334 N/A INTRINSIC
low complexity region 1336 1351 N/A INTRINSIC
low complexity region 1395 1422 N/A INTRINSIC
low complexity region 1433 1447 N/A INTRINSIC
low complexity region 1485 1514 N/A INTRINSIC
internal_repeat_1 1517 1560 2e-5 PROSPERO
internal_repeat_2 1518 1540 5.08e-5 PROSPERO
internal_repeat_2 1550 1570 5.08e-5 PROSPERO
low complexity region 1571 1588 N/A INTRINSIC
low complexity region 1590 1608 N/A INTRINSIC
low complexity region 1625 1659 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
low complexity region 1809 1821 N/A INTRINSIC
HELICc 1897 1980 1.2e-28 SMART
low complexity region 2039 2059 N/A INTRINSIC
coiled coil region 2147 2182 N/A INTRINSIC
low complexity region 2263 2329 N/A INTRINSIC
low complexity region 2355 2390 N/A INTRINSIC
low complexity region 2569 2581 N/A INTRINSIC
low complexity region 2623 2638 N/A INTRINSIC
low complexity region 2666 2693 N/A INTRINSIC
AT_hook 2726 2738 2.4e-2 SMART
low complexity region 2778 2798 N/A INTRINSIC
AT_hook 2806 2818 2.6e-3 SMART
low complexity region 2819 2830 N/A INTRINSIC
low complexity region 2839 2866 N/A INTRINSIC
AT_hook 2870 2882 2.4e-3 SMART
low complexity region 2915 2926 N/A INTRINSIC
low complexity region 2927 2937 N/A INTRINSIC
low complexity region 3024 3060 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190278
SMART Domains Protein: ENSMUSP00000144111
Gene: ENSMUSG00000106715

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000190390
AA Change: V2609A
SMART Domains Protein: ENSMUSP00000139399
Gene: ENSMUSG00000053877
AA Change: V2609A

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
HSA 125 196 5.4e-25 SMART
low complexity region 257 280 N/A INTRINSIC
low complexity region 283 310 N/A INTRINSIC
low complexity region 322 347 N/A INTRINSIC
low complexity region 396 420 N/A INTRINSIC
low complexity region 480 558 N/A INTRINSIC
low complexity region 577 592 N/A INTRINSIC
DEXDc 626 818 5e-37 SMART
low complexity region 993 1001 N/A INTRINSIC
low complexity region 1027 1042 N/A INTRINSIC
low complexity region 1046 1063 N/A INTRINSIC
low complexity region 1120 1143 N/A INTRINSIC
low complexity region 1150 1178 N/A INTRINSIC
low complexity region 1271 1290 N/A INTRINSIC
internal_repeat_1 1298 1341 2.01e-5 PROSPERO
low complexity region 1370 1398 N/A INTRINSIC
low complexity region 1400 1414 N/A INTRINSIC
low complexity region 1431 1449 N/A INTRINSIC
low complexity region 1451 1466 N/A INTRINSIC
low complexity region 1510 1537 N/A INTRINSIC
low complexity region 1548 1562 N/A INTRINSIC
low complexity region 1600 1629 N/A INTRINSIC
internal_repeat_1 1632 1675 2.01e-5 PROSPERO
internal_repeat_2 1633 1655 5.11e-5 PROSPERO
internal_repeat_2 1665 1685 5.11e-5 PROSPERO
low complexity region 1686 1703 N/A INTRINSIC
low complexity region 1705 1723 N/A INTRINSIC
low complexity region 1740 1774 N/A INTRINSIC
low complexity region 1809 1822 N/A INTRINSIC
low complexity region 1924 1936 N/A INTRINSIC
HELICc 2012 2095 1.2e-28 SMART
low complexity region 2154 2174 N/A INTRINSIC
coiled coil region 2262 2297 N/A INTRINSIC
low complexity region 2378 2444 N/A INTRINSIC
low complexity region 2470 2505 N/A INTRINSIC
low complexity region 2684 2696 N/A INTRINSIC
low complexity region 2738 2753 N/A INTRINSIC
low complexity region 2781 2808 N/A INTRINSIC
AT_hook 2841 2853 2.4e-2 SMART
low complexity region 2893 2913 N/A INTRINSIC
AT_hook 2921 2933 2.6e-3 SMART
low complexity region 2934 2945 N/A INTRINSIC
low complexity region 2954 2981 N/A INTRINSIC
AT_hook 2985 2997 2.4e-3 SMART
low complexity region 3030 3041 N/A INTRINSIC
low complexity region 3042 3052 N/A INTRINSIC
low complexity region 3139 3175 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190938
Predicted Effect probably benign
Transcript: ENSMUST00000206825
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the core catalytic component of the multiprotein chromatin-remodeling SRCAP complex. The encoded protein is an ATPase that is necessary for the incorporation of the histone variant H2A.Z into nucleosomes. It can function as a transcriptional activator in Notch-mediated, CREB-mediated and steroid receptor-mediated transcription. Mutations in this gene cause Floating-Harbor syndrome, a rare disorder characterized by short stature, language deficits and dysmorphic facial features. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,246,980 H618L probably benign Het
Adgrl3 A G 5: 81,766,234 T1230A probably benign Het
Ahnak2 A G 12: 112,785,739 S203P probably benign Het
Allc A G 12: 28,559,309 V244A probably benign Het
Ap3m1 G A 14: 21,037,157 P157L probably damaging Het
Arhgef2 T G 3: 88,632,943 I97S probably damaging Het
Btaf1 C A 19: 36,966,785 T398K probably benign Het
Cabp1 T C 5: 115,173,153 M158V probably damaging Het
Ccdc162 G A 10: 41,673,867 P340L probably benign Het
Clip4 A G 17: 71,834,222 K524E probably damaging Het
Cltc A G 11: 86,695,648 V189A probably benign Het
Cmc2 A G 8: 116,894,140 F34S probably damaging Het
Ctcfl G T 2: 173,113,656 T271N probably benign Het
Cyp4f16 T A 17: 32,542,764 F124I possibly damaging Het
Ddx41 C A 13: 55,531,648 R479L possibly damaging Het
Dgcr6 C A 16: 18,066,846 N87K possibly damaging Het
Dll1 A G 17: 15,368,859 L518P probably damaging Het
Dnaja4 G T 9: 54,710,644 M263I probably benign Het
Dusp13 T A 14: 21,743,525 probably benign Het
Fam185a T A 5: 21,480,377 I357N probably benign Het
Fam186a T C 15: 99,940,797 Y2522C unknown Het
Fam222a T A 5: 114,594,397 C4* probably null Het
Filip1 T C 9: 79,819,459 D626G probably damaging Het
Ghrhr C T 6: 55,388,187 R389C probably damaging Het
Gm8251 G A 1: 44,061,434 T168I possibly damaging Het
Gstm3 T A 3: 107,964,215 T217S probably benign Het
Gucy2g T C 19: 55,226,053 T548A probably benign Het
Hectd3 T A 4: 117,002,597 C744S probably null Het
Hnrnpl T C 7: 28,817,337 S184P probably benign Het
Il3 G A 11: 54,267,257 probably benign Het
Itga5 C T 15: 103,354,084 G330S probably damaging Het
Kl A G 5: 150,980,847 T355A possibly damaging Het
Lipk A C 19: 34,032,320 S208R probably damaging Het
Mrs2 T A 13: 24,999,057 probably null Het
Mutyh A G 4: 116,817,690 E372G probably damaging Het
Myh4 C A 11: 67,258,992 A1821D probably benign Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Nlrp12 T C 7: 3,231,061 E881G probably damaging Het
Nol9 T C 4: 152,052,095 probably benign Het
Nwd1 A G 8: 72,657,131 E52G probably damaging Het
Olfr1025-ps1 A G 2: 85,918,404 T160A probably benign Het
Olfr1294 T A 2: 111,537,974 H105L probably damaging Het
Olfr1415 A G 1: 92,490,975 V260A probably benign Het
Olfr1508 A T 14: 52,463,646 M121K probably damaging Het
Olfr449 T G 6: 42,837,849 probably null Het
Opn4 A G 14: 34,596,304 V242A probably damaging Het
Paxbp1 G A 16: 91,034,978 Q341* probably null Het
Pcdh7 T C 5: 57,720,411 V436A possibly damaging Het
Pcdhb18 G A 18: 37,489,814 V66M probably damaging Het
Pikfyve A G 1: 65,246,590 E951G possibly damaging Het
Plcg1 A G 2: 160,750,986 N179S probably benign Het
Prr11 A C 11: 87,098,691 S285A probably benign Het
Ranbp17 A G 11: 33,328,451 S139P probably damaging Het
Rasa4 G A 5: 136,091,810 probably null Het
Rnf213 G C 11: 119,442,763 G2934R probably benign Het
Rpap1 A G 2: 119,778,251 V210A probably benign Het
Rpn1 T A 6: 88,090,205 N182K probably benign Het
Rps24 C T 14: 24,491,787 T14I possibly damaging Het
Rrp12 C T 19: 41,877,505 probably null Het
Rttn T A 18: 89,090,415 probably null Het
Rufy1 A G 11: 50,401,493 S490P probably damaging Het
Sec62 T A 3: 30,809,869 M100K unknown Het
Spata16 A G 3: 26,732,932 H253R possibly damaging Het
Srrm1 A G 4: 135,345,512 probably benign Het
Tbcd G A 11: 121,582,785 probably null Het
Tedc2 C A 17: 24,220,593 A25S probably damaging Het
Tnr A T 1: 159,684,788 probably benign Het
Tnxb A C 17: 34,718,007 D3730A probably damaging Het
Tor2a G A 2: 32,760,597 G201D probably damaging Het
Tpp1 T C 7: 105,746,649 T558A probably benign Het
Vmn1r211 G T 13: 22,852,126 Q124K probably benign Het
Wasf3 T C 5: 146,460,978 V185A probably benign Het
Zbtb12 A G 17: 34,896,009 T257A probably benign Het
Other mutations in Srcap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Srcap APN 7 127542713 splice site probably benign
IGL00475:Srcap APN 7 127552921 missense possibly damaging 0.92
IGL01064:Srcap APN 7 127559892 unclassified probably benign
IGL01129:Srcap APN 7 127521651 missense probably damaging 1.00
IGL01670:Srcap APN 7 127528432 missense probably damaging 1.00
IGL01861:Srcap APN 7 127525285 splice site probably benign
IGL02237:Srcap APN 7 127534692 splice site probably benign
IGL02665:Srcap APN 7 127540903 missense probably damaging 1.00
IGL02688:Srcap APN 7 127542453 missense probably benign 0.04
IGL02744:Srcap APN 7 127534666 missense probably damaging 1.00
IGL02810:Srcap APN 7 127521663 critical splice donor site probably null
IGL03184:Srcap APN 7 127530502 unclassified probably benign
IGL03309:Srcap APN 7 127530793 missense probably damaging 0.99
PIT4453001:Srcap UTSW 7 127549320 missense possibly damaging 0.52
R1340:Srcap UTSW 7 127560738 intron probably benign
R1401:Srcap UTSW 7 127559952 unclassified probably benign
R1455:Srcap UTSW 7 127530650 missense probably damaging 0.99
R1470:Srcap UTSW 7 127559727 unclassified probably benign
R1470:Srcap UTSW 7 127559727 unclassified probably benign
R1761:Srcap UTSW 7 127534845 missense probably damaging 1.00
R1911:Srcap UTSW 7 127534822 missense probably damaging 0.99
R2483:Srcap UTSW 7 127542147 missense probably damaging 0.99
R2892:Srcap UTSW 7 127539065 missense probably damaging 0.99
R2893:Srcap UTSW 7 127539065 missense probably damaging 0.99
R3623:Srcap UTSW 7 127542147 missense probably damaging 0.99
R3976:Srcap UTSW 7 127549239 missense probably benign 0.18
R4001:Srcap UTSW 7 127532167 missense probably damaging 1.00
R4015:Srcap UTSW 7 127525423 missense probably benign 0.27
R4581:Srcap UTSW 7 127558310 unclassified probably benign
R4643:Srcap UTSW 7 127541776 missense probably damaging 1.00
R4644:Srcap UTSW 7 127552598 missense probably damaging 1.00
R4690:Srcap UTSW 7 127538014 missense probably damaging 1.00
R4693:Srcap UTSW 7 127538544 missense probably damaging 1.00
R4719:Srcap UTSW 7 127541559 missense probably benign 0.13
R4728:Srcap UTSW 7 127540924 critical splice donor site probably null
R4740:Srcap UTSW 7 127549299 missense probably damaging 1.00
R4752:Srcap UTSW 7 127559000 unclassified probably benign
R4834:Srcap UTSW 7 127557610 critical splice donor site probably null
R4884:Srcap UTSW 7 127522017 missense probably damaging 1.00
R4889:Srcap UTSW 7 127538547 missense possibly damaging 0.94
R5088:Srcap UTSW 7 127541661 missense probably benign 0.02
R5102:Srcap UTSW 7 127530623 missense probably damaging 1.00
R5358:Srcap UTSW 7 127540320 missense probably damaging 1.00
R5372:Srcap UTSW 7 127557613 splice site probably null
R5397:Srcap UTSW 7 127553296 critical splice donor site probably null
R5481:Srcap UTSW 7 127532197 missense probably damaging 1.00
R5566:Srcap UTSW 7 127525303 missense probably damaging 0.99
R5584:Srcap UTSW 7 127528479 missense probably damaging 1.00
R5693:Srcap UTSW 7 127519816 missense probably damaging 1.00
R5769:Srcap UTSW 7 127559822 unclassified probably benign
R5805:Srcap UTSW 7 127542039 missense possibly damaging 0.87
R5806:Srcap UTSW 7 127559163 unclassified probably benign
R5921:Srcap UTSW 7 127558833 unclassified probably benign
R5942:Srcap UTSW 7 127538008 missense probably damaging 1.00
R6014:Srcap UTSW 7 127538750 missense probably benign 0.01
R6057:Srcap UTSW 7 127541356 missense probably damaging 0.99
R6113:Srcap UTSW 7 127560281 unclassified probably benign
R6150:Srcap UTSW 7 127534828 missense probably damaging 1.00
R6212:Srcap UTSW 7 127549689 missense probably damaging 1.00
R6299:Srcap UTSW 7 127530454 unclassified probably benign
R6437:Srcap UTSW 7 127528550 intron probably null
R6492:Srcap UTSW 7 127522145 nonsense probably null
R6537:Srcap UTSW 7 127542220 missense probably damaging 0.97
R6659:Srcap UTSW 7 127542391 missense probably damaging 1.00
R6713:Srcap UTSW 7 127534917 missense probably benign 0.28
R6717:Srcap UTSW 7 127558310 unclassified probably benign
R6941:Srcap UTSW 7 127542597 missense probably damaging 1.00
R7068:Srcap UTSW 7 127541943 missense probably benign 0.00
R7097:Srcap UTSW 7 127539041 missense probably damaging 1.00
R7394:Srcap UTSW 7 127534828 missense probably damaging 1.00
R7426:Srcap UTSW 7 127538517 missense possibly damaging 0.90
R7434:Srcap UTSW 7 127560242 missense unknown
R7559:Srcap UTSW 7 127530550 missense unknown
R7638:Srcap UTSW 7 127538748 missense probably benign 0.39
R7677:Srcap UTSW 7 127559808 missense unknown
R7715:Srcap UTSW 7 127549288 missense probably damaging 0.99
X0025:Srcap UTSW 7 127560105 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TAGAGCTGCCTGGAATGACC -3'
(R):5'- ACCTCAGCTCTAACAAGTTCTTG -3'

Sequencing Primer
(F):5'- GGAATGACCAATTCTGAGGCTTCC -3'
(R):5'- GGAAATTGGGATCTGAACCTCTC -3'
Posted On2016-03-01