Mutagenetix > Incidental Mutation

Incidental Mutation 'R4837:Filip1'

374348

Institutional Source

Beutler Lab

Gene Symbol

Filip1

Ensembl Gene

ENSMUSG00000034898

Gene Name

filamin A interacting protein 1

Synonyms

5730485H21Rik

MMRRC Submission

042452-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.381) question?

Stock #

R4837 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

79815051-80012851 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 79819459 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 626 (D626G)

Ref Sequence

ENSEMBL: ENSMUSP00000091329 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093811] [ENSMUST00000172973]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000093811
AA Change: D626G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000091329
Gene: ENSMUSG00000034898
AA Change: D626G

Domain	Start	End	E-Value	Type
Pfam:CortBP2	71	256	2.1e-64	PFAM
coiled coil region	258	540	N/A	INTRINSIC
low complexity region	545	564	N/A	INTRINSIC
low complexity region	579	592	N/A	INTRINSIC
coiled coil region	625	778	N/A	INTRINSIC
low complexity region	928	940	N/A	INTRINSIC
low complexity region	1126	1140	N/A	INTRINSIC
low complexity region	1168	1180	N/A	INTRINSIC
low complexity region	1198	1214	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172740

Predicted Effect

probably benign
Transcript: ENSMUST00000172973

SMART Domains

Protein: ENSMUSP00000134427
Gene: ENSMUSG00000034898

Domain	Start	End	E-Value	Type
Pfam:CortBP2	65	225	5.2e-74	PFAM

Meta Mutation Damage Score

0.2026

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.9%

Validation Efficiency

99% (75/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a filamin A binding protein. The encoded protein promotes the degradation of filamin A and may regulate cortical neuron migration and dendritic spine morphology. Mice lacking a functional copy of this gene exhibit reduced dendritic spine length and altered excitatory signaling. [provided by RefSeq, Oct 2016]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	A	T	7: 120,246,980	H618L	probably benign	Het
Adgrl3	A	G	5: 81,766,234	T1230A	probably benign	Het
Ahnak2	A	G	12: 112,785,739	S203P	probably benign	Het
Allc	A	G	12: 28,559,309	V244A	probably benign	Het
Ap3m1	G	A	14: 21,037,157	P157L	probably damaging	Het
Arhgef2	T	G	3: 88,632,943	I97S	probably damaging	Het
Btaf1	C	A	19: 36,966,785	T398K	probably benign	Het
Cabp1	T	C	5: 115,173,153	M158V	probably damaging	Het
Ccdc162	G	A	10: 41,673,867	P340L	probably benign	Het
Clip4	A	G	17: 71,834,222	K524E	probably damaging	Het
Cltc	A	G	11: 86,695,648	V189A	probably benign	Het
Cmc2	A	G	8: 116,894,140	F34S	probably damaging	Het
Ctcfl	G	T	2: 173,113,656	T271N	probably benign	Het
Cyp4f16	T	A	17: 32,542,764	F124I	possibly damaging	Het
Ddx41	C	A	13: 55,531,648	R479L	possibly damaging	Het
Dgcr6	C	A	16: 18,066,846	N87K	possibly damaging	Het
Dll1	A	G	17: 15,368,859	L518P	probably damaging	Het
Dnaja4	G	T	9: 54,710,644	M263I	probably benign	Het
Dusp13	T	A	14: 21,743,525		probably benign	Het
Fam185a	T	A	5: 21,480,377	I357N	probably benign	Het
Fam186a	T	C	15: 99,940,797	Y2522C	unknown	Het
Fam222a	T	A	5: 114,594,397	C4*	probably null	Het
Ghrhr	C	T	6: 55,388,187	R389C	probably damaging	Het
Gm8251	G	A	1: 44,061,434	T168I	possibly damaging	Het
Gstm3	T	A	3: 107,964,215	T217S	probably benign	Het
Gucy2g	T	C	19: 55,226,053	T548A	probably benign	Het
Hectd3	T	A	4: 117,002,597	C744S	probably null	Het
Hnrnpl	T	C	7: 28,817,337	S184P	probably benign	Het
Il3	G	A	11: 54,267,257		probably benign	Het
Itga5	C	T	15: 103,354,084	G330S	probably damaging	Het
Kl	A	G	5: 150,980,847	T355A	possibly damaging	Het
Lipk	A	C	19: 34,032,320	S208R	probably damaging	Het
Mrs2	T	A	13: 24,999,057		probably null	Het
Mutyh	A	G	4: 116,817,690	E372G	probably damaging	Het
Myh4	C	A	11: 67,258,992	A1821D	probably benign	Het
Nfkb2	G	T	19: 46,307,567	E170D	probably benign	Het
Nlrp12	T	C	7: 3,231,061	E881G	probably damaging	Het
Nol9	T	C	4: 152,052,095		probably benign	Het
Nwd1	A	G	8: 72,657,131	E52G	probably damaging	Het
Olfr1025-ps1	A	G	2: 85,918,404	T160A	probably benign	Het
Olfr1294	T	A	2: 111,537,974	H105L	probably damaging	Het
Olfr1415	A	G	1: 92,490,975	V260A	probably benign	Het
Olfr1508	A	T	14: 52,463,646	M121K	probably damaging	Het
Olfr449	T	G	6: 42,837,849		probably null	Het
Opn4	A	G	14: 34,596,304	V242A	probably damaging	Het
Paxbp1	G	A	16: 91,034,978	Q341*	probably null	Het
Pcdh7	T	C	5: 57,720,411	V436A	possibly damaging	Het
Pcdhb18	G	A	18: 37,489,814	V66M	probably damaging	Het
Pikfyve	A	G	1: 65,246,590	E951G	possibly damaging	Het
Plcg1	A	G	2: 160,750,986	N179S	probably benign	Het
Prr11	A	C	11: 87,098,691	S285A	probably benign	Het
Ranbp17	A	G	11: 33,328,451	S139P	probably damaging	Het
Rasa4	G	A	5: 136,091,810		probably null	Het
Rnf213	G	C	11: 119,442,763	G2934R	probably benign	Het
Rpap1	A	G	2: 119,778,251	V210A	probably benign	Het
Rpn1	T	A	6: 88,090,205	N182K	probably benign	Het
Rps24	C	T	14: 24,491,787	T14I	possibly damaging	Het
Rrp12	C	T	19: 41,877,505		probably null	Het
Rttn	T	A	18: 89,090,415		probably null	Het
Rufy1	A	G	11: 50,401,493	S490P	probably damaging	Het
Sec62	T	A	3: 30,809,869	M100K	unknown	Het
Spata16	A	G	3: 26,732,932	H253R	possibly damaging	Het
Srcap	T	C	7: 127,558,962		probably benign	Het
Srrm1	A	G	4: 135,345,512		probably benign	Het
Tbcd	G	A	11: 121,582,785		probably null	Het
Tedc2	C	A	17: 24,220,593	A25S	probably damaging	Het
Tnr	A	T	1: 159,684,788		probably benign	Het
Tnxb	A	C	17: 34,718,007	D3730A	probably damaging	Het
Tor2a	G	A	2: 32,760,597	G201D	probably damaging	Het
Tpp1	T	C	7: 105,746,649	T558A	probably benign	Het
Vmn1r211	G	T	13: 22,852,126	Q124K	probably benign	Het
Wasf3	T	C	5: 146,460,978	V185A	probably benign	Het
Zbtb12	A	G	17: 34,896,009	T257A	probably benign	Het

Other mutations in Filip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Filip1	APN	9	79817944	missense	probably damaging	1.00
IGL01101:Filip1	APN	9	79898246	missense	probably benign	0.44
IGL01301:Filip1	APN	9	79819180	missense	possibly damaging	0.93
IGL01887:Filip1	APN	9	79819617	missense	probably benign	0.42
IGL02119:Filip1	APN	9	79818266	missense	probably benign
IGL02285:Filip1	APN	9	79820126	missense	probably damaging	1.00
IGL02395:Filip1	APN	9	79898410	missense	probably benign	0.01
IGL03398:Filip1	APN	9	79818943	missense	probably benign	0.03
IGL03400:Filip1	APN	9	79820473	missense	probably benign	0.01
IGL03404:Filip1	APN	9	79818559	missense	probably damaging	0.99
ANU18:Filip1	UTSW	9	79819180	missense	possibly damaging	0.93
BB010:Filip1	UTSW	9	79820047	missense	possibly damaging	0.65
BB020:Filip1	UTSW	9	79820047	missense	possibly damaging	0.65
R0101:Filip1	UTSW	9	79819528	missense	probably benign	0.04
R0243:Filip1	UTSW	9	79819003	missense	probably damaging	0.98
R0244:Filip1	UTSW	9	79819462	missense	possibly damaging	0.87
R0371:Filip1	UTSW	9	79860091	missense	probably damaging	1.00
R0399:Filip1	UTSW	9	79818310	missense	possibly damaging	0.71
R0412:Filip1	UTSW	9	79820289	missense	possibly damaging	0.59
R0671:Filip1	UTSW	9	79819390	missense	probably damaging	1.00
R1314:Filip1	UTSW	9	79820566	missense	probably damaging	1.00
R1465:Filip1	UTSW	9	79898307	missense	probably benign	0.25
R1465:Filip1	UTSW	9	79898307	missense	probably benign	0.25
R1602:Filip1	UTSW	9	79820591	missense	probably damaging	0.99
R1801:Filip1	UTSW	9	79815846	missense	probably damaging	0.98
R1929:Filip1	UTSW	9	79819930	missense	probably damaging	1.00
R1983:Filip1	UTSW	9	79860092	missense	probably damaging	1.00
R2066:Filip1	UTSW	9	79820216	missense	probably damaging	1.00
R2128:Filip1	UTSW	9	79819330	missense	probably damaging	0.99
R2271:Filip1	UTSW	9	79819930	missense	probably damaging	1.00
R2411:Filip1	UTSW	9	79898433	missense	probably damaging	0.98
R3429:Filip1	UTSW	9	79853670	missense	probably damaging	1.00
R3430:Filip1	UTSW	9	79853670	missense	probably damaging	1.00
R3945:Filip1	UTSW	9	79818367	missense	probably benign	0.01
R4007:Filip1	UTSW	9	79818727	missense	possibly damaging	0.71
R4583:Filip1	UTSW	9	79815809	missense	possibly damaging	0.76
R4803:Filip1	UTSW	9	79820114	missense	probably benign	0.05
R4910:Filip1	UTSW	9	79817932	missense	probably benign	0.00
R4929:Filip1	UTSW	9	79819747	missense	probably benign	0.07
R5387:Filip1	UTSW	9	79818274	missense	probably benign
R5581:Filip1	UTSW	9	79819760	missense	possibly damaging	0.95
R5808:Filip1	UTSW	9	79818701	missense	possibly damaging	0.67
R5891:Filip1	UTSW	9	79819860	missense	possibly damaging	0.69
R6166:Filip1	UTSW	9	79819454	missense	probably damaging	0.99
R6273:Filip1	UTSW	9	79815886	missense	probably benign	0.01
R6380:Filip1	UTSW	9	79819624	missense	probably damaging	0.99
R6385:Filip1	UTSW	9	79820531	missense	possibly damaging	0.68
R6614:Filip1	UTSW	9	79815839	missense	probably damaging	1.00
R6715:Filip1	UTSW	9	79818758	missense	probably benign	0.03
R7047:Filip1	UTSW	9	79853634	missense	probably damaging	0.98
R7126:Filip1	UTSW	9	79898295	missense	possibly damaging	0.88
R7144:Filip1	UTSW	9	79820213	missense	possibly damaging	0.65
R7218:Filip1	UTSW	9	79818074	missense	probably benign
R7404:Filip1	UTSW	9	79820098	missense	possibly damaging	0.94
R7702:Filip1	UTSW	9	79820649	missense	probably benign	0.20
R7866:Filip1	UTSW	9	79818943	missense	probably benign	0.03
R7933:Filip1	UTSW	9	79820047	missense	possibly damaging	0.65
R8012:Filip1	UTSW	9	79817959	missense	probably damaging	0.97
R8097:Filip1	UTSW	9	79818259	missense	probably benign
R8213:Filip1	UTSW	9	79818092	missense	probably benign	0.01
R8305:Filip1	UTSW	9	79820475	nonsense	probably null
R8798:Filip1	UTSW	9	79820090	missense	possibly damaging	0.94
R9184:Filip1	UTSW	9	79898260	missense	probably benign	0.03
R9322:Filip1	UTSW	9	79819732	missense	probably benign	0.01
R9334:Filip1	UTSW	9	79818457	missense	probably benign	0.32
R9353:Filip1	UTSW	9	79818341	missense	possibly damaging	0.67
R9541:Filip1	UTSW	9	79819853	nonsense	probably null
R9607:Filip1	UTSW	9	79819120	missense	probably damaging	1.00
X0054:Filip1	UTSW	9	79819535	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AATTTCCTCGAGCTGCTGGG -3'
(R):5'- TGTGACGGAGAAGCTAATCG -3'

Sequencing Primer
(F):5'- GAGAGGAAATTTGCCTTATCCTGCTC -3'
(R):5'- GGTGTATAGTCTGACCAAGGAG -3'

Posted On

2016-03-01