Incidental Mutation 'R0280:Ankrd16'
ID37437
Institutional Source Beutler Lab
Gene Symbol Ankrd16
Ensembl Gene ENSMUSG00000047909
Gene Nameankyrin repeat domain 16
Synonyms2810455F06Rik, D430029B21Rik
MMRRC Submission 038502-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R0280 (G1)
Quality Score215
Status Validated
Chromosome2
Chromosomal Location11777876-11790329 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 11781501 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 187 (V187G)
Ref Sequence ENSEMBL: ENSMUSP00000052056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056108] [ENSMUST00000071564] [ENSMUST00000130186] [ENSMUST00000133664] [ENSMUST00000156067]
Predicted Effect probably damaging
Transcript: ENSMUST00000056108
AA Change: V187G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052056
Gene: ENSMUSG00000047909
AA Change: V187G

DomainStartEndE-ValueType
ANK 36 66 1.15e0 SMART
ANK 70 99 7.95e-4 SMART
ANK 103 132 1.59e-3 SMART
ANK 136 167 1.74e0 SMART
ANK 170 200 7.71e-2 SMART
ANK 204 233 5.01e-1 SMART
ANK 238 268 1.37e2 SMART
ANK 273 302 7.53e-5 SMART
ANK 306 336 4.07e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000071564
SMART Domains Protein: ENSMUSP00000071495
Gene: ENSMUSG00000058594

DomainStartEndE-ValueType
FBOX 213 256 3.94e-3 SMART
Pfam:UvrD-helicase 626 692 8e-10 PFAM
Pfam:UvrD_C 862 935 1.7e-12 PFAM
Pfam:UvrD_C_2 867 931 1.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125024
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126543
Predicted Effect probably benign
Transcript: ENSMUST00000128774
SMART Domains Protein: ENSMUSP00000121218
Gene: ENSMUSG00000047909

DomainStartEndE-ValueType
Pfam:Ank_4 10 65 1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130186
SMART Domains Protein: ENSMUSP00000141685
Gene: ENSMUSG00000047909

DomainStartEndE-ValueType
ANK 36 66 7.2e-3 SMART
Pfam:Ank 72 90 7.9e-3 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000133664
AA Change: V13G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000115226
Gene: ENSMUSG00000047909
AA Change: V13G

DomainStartEndE-ValueType
Pfam:Ank 1 29 1.5e-3 PFAM
Pfam:Ank_4 1 51 7.3e-11 PFAM
Pfam:Ank_2 1 56 8.9e-11 PFAM
Pfam:Ank_5 18 56 1.8e-6 PFAM
Pfam:Ank 30 55 3e-5 PFAM
Pfam:Ank_3 30 55 2.7e-3 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142622
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150213
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150320
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151402
Predicted Effect possibly damaging
Transcript: ENSMUST00000156067
AA Change: S162R

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115525
Gene: ENSMUSG00000047909
AA Change: S162R

DomainStartEndE-ValueType
ANK 36 66 1.15e0 SMART
ANK 70 99 7.95e-4 SMART
ANK 103 132 1.59e-3 SMART
ANK 136 165 9.46e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194100
Meta Mutation Damage Score 0.8997 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 96% (55/57)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Adam18 C T 8: 24,674,054 G38R probably benign Het
AU019823 T C 9: 50,609,379 T123A probably damaging Het
Ccdc110 A T 8: 45,943,450 N793Y probably benign Het
Ccdc170 T C 10: 4,558,663 I629T possibly damaging Het
Clcn6 A G 4: 148,008,715 L836P probably damaging Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Crocc T C 4: 141,028,426 E1097G probably damaging Het
Csmd1 A T 8: 16,271,602 V494E probably damaging Het
Drg1 A T 11: 3,256,537 probably null Het
Dscam T C 16: 97,039,006 K134E possibly damaging Het
Dyrk1b T C 7: 28,184,312 Y198H probably damaging Het
Esr1 A G 10: 4,856,951 D289G probably benign Het
Esr1 G T 10: 4,939,289 V396F probably damaging Het
Evi5l T C 8: 4,193,133 V339A probably damaging Het
Fat4 A T 3: 38,890,816 Q1286L probably benign Het
Frem1 T C 4: 82,969,444 H1118R probably damaging Het
Fuk A T 8: 110,894,748 V188D probably damaging Het
Fut9 C T 4: 25,619,852 D321N probably benign Het
Gaa T G 11: 119,284,547 V917G probably damaging Het
Gm973 GCC GC 1: 59,544,680 probably null Het
Kidins220 A G 12: 25,010,141 T767A probably damaging Het
Kif7 A G 7: 79,698,823 S1257P probably benign Het
Ltn1 A G 16: 87,397,838 L1391P probably damaging Het
Mast3 A G 8: 70,783,795 Y681H probably damaging Het
Mast3 A G 8: 70,787,920 V291A possibly damaging Het
Metrn C T 17: 25,795,135 R239H probably benign Het
Mphosph10 C A 7: 64,376,703 K666N possibly damaging Het
Mtbp C T 15: 55,586,461 T433I probably benign Het
Mtmr2 A G 9: 13,799,249 K365E probably damaging Het
Nanog A G 6: 122,713,398 D229G probably damaging Het
Npepps T C 11: 97,241,014 N338S possibly damaging Het
Nphp4 T A 4: 152,551,936 probably benign Het
Olfr1279 T C 2: 111,307,072 F289S possibly damaging Het
Plcl2 A G 17: 50,607,034 E357G probably damaging Het
Polb A T 8: 22,640,392 Y173N probably damaging Het
R3hdm1 T A 1: 128,162,775 S74T probably benign Het
Raet1d T A 10: 22,370,883 C37S probably damaging Het
Reln G A 5: 22,227,513 probably benign Het
Rps6kc1 T C 1: 190,809,000 S369G probably damaging Het
Sgf29 A G 7: 126,671,571 E108G probably benign Het
Sh3tc1 A G 5: 35,706,017 L942P probably damaging Het
Slc22a27 A T 19: 7,896,822 L188* probably null Het
Slc9a3 T A 13: 74,159,424 I445N probably damaging Het
Sufu A T 19: 46,450,673 probably benign Het
Tomm40 G A 7: 19,713,751 T118I probably damaging Het
Ttc25 A T 11: 100,550,265 K107N probably damaging Het
Ttn C T 2: 76,740,479 R26690H probably damaging Het
Vmn2r16 A G 5: 109,340,139 I293V possibly damaging Het
Vmn2r68 T A 7: 85,233,249 probably benign Het
Vmn2r68 C G 7: 85,233,258 probably null Het
Vsig8 A G 1: 172,561,538 D119G probably benign Het
Other mutations in Ankrd16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01663:Ankrd16 APN 2 11778662 missense probably damaging 1.00
R0521:Ankrd16 UTSW 2 11789881 missense probably benign
R1441:Ankrd16 UTSW 2 11778746 missense probably damaging 1.00
R1699:Ankrd16 UTSW 2 11784393 missense probably benign
R1858:Ankrd16 UTSW 2 11778596 missense probably benign
R1944:Ankrd16 UTSW 2 11783632 splice site probably null
R2074:Ankrd16 UTSW 2 11789748 missense possibly damaging 0.82
R2104:Ankrd16 UTSW 2 11779900 intron probably benign
R2131:Ankrd16 UTSW 2 11783695 missense probably damaging 1.00
R3847:Ankrd16 UTSW 2 11789808 missense probably benign 0.04
R3940:Ankrd16 UTSW 2 11784381 missense probably benign
R4424:Ankrd16 UTSW 2 11784404 missense possibly damaging 0.95
R4707:Ankrd16 UTSW 2 11778797 missense probably damaging 1.00
R4863:Ankrd16 UTSW 2 11784316 missense probably benign 0.05
R5026:Ankrd16 UTSW 2 11789881 missense probably benign 0.05
R5079:Ankrd16 UTSW 2 11778899 missense probably damaging 1.00
R5251:Ankrd16 UTSW 2 11778741 missense probably damaging 1.00
R5304:Ankrd16 UTSW 2 11789734 missense probably benign
R5746:Ankrd16 UTSW 2 11784367 missense probably damaging 0.99
R6932:Ankrd16 UTSW 2 11786243 missense possibly damaging 0.90
R6958:Ankrd16 UTSW 2 11779793 missense probably damaging 1.00
Z1088:Ankrd16 UTSW 2 11779818 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACTCTAGGTGTTTGACCAGGGCAG -3'
(R):5'- CAGCCGTTATCCTCAGGTGAACAG -3'

Sequencing Primer
(F):5'- acctctacccacacatacaaac -3'
(R):5'- GCTGGTGCAGAGACATTTACTC -3'
Posted On2013-05-23